FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630595_at:

>probe:Drosophila_2:1630595_at:464:23; Interrogation_Position=116; Antisense; ATATCCTGGCTAAGGGTCCGGCGAA
>probe:Drosophila_2:1630595_at:116:729; Interrogation_Position=202; Antisense; TTGGCCATCCATCTGATGCCGGCAA
>probe:Drosophila_2:1630595_at:226:289; Interrogation_Position=221; Antisense; CGGCAATCAATCCACTGGCAACTGA
>probe:Drosophila_2:1630595_at:192:329; Interrogation_Position=258; Antisense; GCGTCCGGATACATTCTCATATTTT
>probe:Drosophila_2:1630595_at:107:701; Interrogation_Position=279; Antisense; TTTTCTCCCCGGTCCAAATGAGAAG
>probe:Drosophila_2:1630595_at:295:109; Interrogation_Position=299; Antisense; AGAAGTCTTGCCAGGCTGTGGCCGA
>probe:Drosophila_2:1630595_at:206:523; Interrogation_Position=316; Antisense; GTGGCCGACCGAATCGCTGACGCAA
>probe:Drosophila_2:1630595_at:268:335; Interrogation_Position=331; Antisense; GCTGACGCAAGCGATCGGGTCATCA
>probe:Drosophila_2:1630595_at:259:567; Interrogation_Position=374; Antisense; GGCAAATAAACCACCTGAAGTCTGT
>probe:Drosophila_2:1630595_at:581:373; Interrogation_Position=390; Antisense; GAAGTCTGTGGTGAGCAACCGCCGC
>probe:Drosophila_2:1630595_at:530:251; Interrogation_Position=423; Antisense; CAACCAGTGGGATCGTAACCGTCTT
>probe:Drosophila_2:1630595_at:447:201; Interrogation_Position=439; Antisense; AACCGTCTTGAAATTCTGCTGGCCC
>probe:Drosophila_2:1630595_at:211:621; Interrogation_Position=455; Antisense; TGCTGGCCCAGATCAATGGTGACCC
>probe:Drosophila_2:1630595_at:63:379; Interrogation_Position=534; Antisense; GAAGCGCATAGAGGCCTACGACCAA

Paste this into a BLAST search page for me
ATATCCTGGCTAAGGGTCCGGCGAATTGGCCATCCATCTGATGCCGGCAACGGCAATCAATCCACTGGCAACTGAGCGTCCGGATACATTCTCATATTTTTTTTCTCCCCGGTCCAAATGAGAAGAGAAGTCTTGCCAGGCTGTGGCCGAGTGGCCGACCGAATCGCTGACGCAAGCTGACGCAAGCGATCGGGTCATCAGGCAAATAAACCACCTGAAGTCTGTGAAGTCTGTGGTGAGCAACCGCCGCCAACCAGTGGGATCGTAACCGTCTTAACCGTCTTGAAATTCTGCTGGCCCTGCTGGCCCAGATCAATGGTGACCCGAAGCGCATAGAGGCCTACGACCAA

Full Affymetrix probeset data:

Annotations for 1630595_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720