FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630596_at:

>probe:Drosophila_2:1630596_at:500:25; Interrogation_Position=1106; Antisense; ATAGTTTTCATCAAGGCACCGACGA
>probe:Drosophila_2:1630596_at:530:469; Interrogation_Position=1150; Antisense; GTTGCGCATCAAACAGGCTCCTGTG
>probe:Drosophila_2:1630596_at:643:413; Interrogation_Position=1183; Antisense; GACCATCATCTATGTGCTGACCAAG
>probe:Drosophila_2:1630596_at:530:97; Interrogation_Position=1222; Antisense; AGATCTCCAGACTGCCATCGAGGAA
>probe:Drosophila_2:1630596_at:187:625; Interrogation_Position=1318; Antisense; TGCGCAACGTACCATTCAAGCTCAA
>probe:Drosophila_2:1630596_at:679:343; Interrogation_Position=1351; Antisense; GCTTGGCGGAACATCACAGGTTTCT
>probe:Drosophila_2:1630596_at:315:409; Interrogation_Position=1376; Antisense; GACGAGGGAGTTGCACCCGTTACAT
>probe:Drosophila_2:1630596_at:389:475; Interrogation_Position=1394; Antisense; GTTACATCCGTGATTGGCGTACTGG
>probe:Drosophila_2:1630596_at:140:245; Interrogation_Position=1438; Antisense; AATTTCATCCGGACAGTTTTCTGGC
>probe:Drosophila_2:1630596_at:721:149; Interrogation_Position=1479; Antisense; ACTTGCCAACTAATCTGCGTGCTTA
>probe:Drosophila_2:1630596_at:382:623; Interrogation_Position=1494; Antisense; TGCGTGCTTAGGTACAACTCCAAGG
>probe:Drosophila_2:1630596_at:508:191; Interrogation_Position=1509; Antisense; AACTCCAAGGCCACTGTCGTAATTT
>probe:Drosophila_2:1630596_at:439:91; Interrogation_Position=1575; Antisense; AGTTCATATTTTGAGCTCCGCCTTA
>probe:Drosophila_2:1630596_at:36:175; Interrogation_Position=1606; Antisense; AAAGCGACTCTGCAGCCATATTCAA

Paste this into a BLAST search page for me
ATAGTTTTCATCAAGGCACCGACGAGTTGCGCATCAAACAGGCTCCTGTGGACCATCATCTATGTGCTGACCAAGAGATCTCCAGACTGCCATCGAGGAATGCGCAACGTACCATTCAAGCTCAAGCTTGGCGGAACATCACAGGTTTCTGACGAGGGAGTTGCACCCGTTACATGTTACATCCGTGATTGGCGTACTGGAATTTCATCCGGACAGTTTTCTGGCACTTGCCAACTAATCTGCGTGCTTATGCGTGCTTAGGTACAACTCCAAGGAACTCCAAGGCCACTGTCGTAATTTAGTTCATATTTTGAGCTCCGCCTTAAAAGCGACTCTGCAGCCATATTCAA

Full Affymetrix probeset data:

Annotations for 1630596_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720