FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630600_at:

>probe:Drosophila_2:1630600_at:469:135; Interrogation_Position=440; Antisense; ACGGATGTTACCAGTCCCGCGGAGG
>probe:Drosophila_2:1630600_at:449:549; Interrogation_Position=460; Antisense; GGAGGAGACCACTCTGGCACCCGAG
>probe:Drosophila_2:1630600_at:280:567; Interrogation_Position=475; Antisense; GGCACCCGAGGTTCCAGAAGAATCT
>probe:Drosophila_2:1630600_at:593:365; Interrogation_Position=494; Antisense; GAATCTACCAGTCAGGCACCAGAGG
>probe:Drosophila_2:1630600_at:25:75; Interrogation_Position=516; Antisense; AGGAAATCACCACCGGCTCTGAAGA
>probe:Drosophila_2:1630600_at:242:575; Interrogation_Position=573; Antisense; TGGCCCCTGAAGTTCCGGAGGAATC
>probe:Drosophila_2:1630600_at:550:293; Interrogation_Position=628; Antisense; CGACTCTGAGGATGGTAGCGGTTCT
>probe:Drosophila_2:1630600_at:448:435; Interrogation_Position=653; Antisense; GAGGATACCACTCAGGCTCCGGAAG
>probe:Drosophila_2:1630600_at:579:75; Interrogation_Position=690; Antisense; AGGAGCCTGAAGAATCCACCAGCGA
>probe:Drosophila_2:1630600_at:442:367; Interrogation_Position=773; Antisense; GAATCGACAACCGAGGCGCCTGTAG
>probe:Drosophila_2:1630600_at:46:209; Interrogation_Position=819; Antisense; AAGAATCGACGACCGAGGCTCCCGA
>probe:Drosophila_2:1630600_at:322:511; Interrogation_Position=855; Antisense; GTGAGGCGCCGGAAGAATCCACTAT
>probe:Drosophila_2:1630600_at:529:147; Interrogation_Position=875; Antisense; ACTATCGATTCTTCAGCGGTCTAGG
>probe:Drosophila_2:1630600_at:599:251; Interrogation_Position=919; Antisense; CAAGGTTTCTGGTTCATTTTCTCAA

Paste this into a BLAST search page for me
ACGGATGTTACCAGTCCCGCGGAGGGGAGGAGACCACTCTGGCACCCGAGGGCACCCGAGGTTCCAGAAGAATCTGAATCTACCAGTCAGGCACCAGAGGAGGAAATCACCACCGGCTCTGAAGATGGCCCCTGAAGTTCCGGAGGAATCCGACTCTGAGGATGGTAGCGGTTCTGAGGATACCACTCAGGCTCCGGAAGAGGAGCCTGAAGAATCCACCAGCGAGAATCGACAACCGAGGCGCCTGTAGAAGAATCGACGACCGAGGCTCCCGAGTGAGGCGCCGGAAGAATCCACTATACTATCGATTCTTCAGCGGTCTAGGCAAGGTTTCTGGTTCATTTTCTCAA

Full Affymetrix probeset data:

Annotations for 1630600_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720