FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630601_at:

>probe:Drosophila_2:1630601_at:588:549; Interrogation_Position=1471; Antisense; GGAGGGCAACGATCCAGCAACTACA
>probe:Drosophila_2:1630601_at:480:659; Interrogation_Position=1509; Antisense; TAACTGCGCGCCTGGAACATCGAAT
>probe:Drosophila_2:1630601_at:58:385; Interrogation_Position=1523; Antisense; GAACATCGAATGGTCTTTGCCAAGT
>probe:Drosophila_2:1630601_at:649:475; Interrogation_Position=1563; Antisense; GTTATTTGTTGCACCAGATTTCGCA
>probe:Drosophila_2:1630601_at:581:459; Interrogation_Position=1579; Antisense; GATTTCGCAATCTTATTTGGACCAA
>probe:Drosophila_2:1630601_at:125:83; Interrogation_Position=1603; Antisense; AGGGCGTCATTCAGAGTGCACTTAC
>probe:Drosophila_2:1630601_at:609:85; Interrogation_Position=1617; Antisense; AGTGCACTTACAATGCTCGCAAGGC
>probe:Drosophila_2:1630601_at:268:373; Interrogation_Position=1678; Antisense; GAAGTTCCTCAGTGTGGTTCAGATA
>probe:Drosophila_2:1630601_at:701:227; Interrogation_Position=1706; Antisense; AAGGCCAATGCCATTCTGCACAAGC
>probe:Drosophila_2:1630601_at:466:379; Interrogation_Position=1745; Antisense; GAAGCCCTAGAAGATGCTCTGCCCA
>probe:Drosophila_2:1630601_at:518:283; Interrogation_Position=1763; Antisense; CTGCCCATTGCTCATTTTCTGAAAT
>probe:Drosophila_2:1630601_at:626:539; Interrogation_Position=1837; Antisense; GGATTCGATCAACAAGCGGGCCACC
>probe:Drosophila_2:1630601_at:690:319; Interrogation_Position=1875; Antisense; GCCGCGTGAGCAAGTCCGAATCTGT
>probe:Drosophila_2:1630601_at:644:1; Interrogation_Position=1926; Antisense; AGGATGTCGACTCCCAAGGTGGTTA

Paste this into a BLAST search page for me
GGAGGGCAACGATCCAGCAACTACATAACTGCGCGCCTGGAACATCGAATGAACATCGAATGGTCTTTGCCAAGTGTTATTTGTTGCACCAGATTTCGCAGATTTCGCAATCTTATTTGGACCAAAGGGCGTCATTCAGAGTGCACTTACAGTGCACTTACAATGCTCGCAAGGCGAAGTTCCTCAGTGTGGTTCAGATAAAGGCCAATGCCATTCTGCACAAGCGAAGCCCTAGAAGATGCTCTGCCCACTGCCCATTGCTCATTTTCTGAAATGGATTCGATCAACAAGCGGGCCACCGCCGCGTGAGCAAGTCCGAATCTGTAGGATGTCGACTCCCAAGGTGGTTA

Full Affymetrix probeset data:

Annotations for 1630601_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720