Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630603_at:

>probe:Drosophila_2:1630603_at:629:445; Interrogation_Position=2718; Antisense; GATGCTGCGCCATCTGTCGGACATC
>probe:Drosophila_2:1630603_at:349:11; Interrogation_Position=2745; Antisense; ATTCGAACACATCTTGCAGTGCGCC
>probe:Drosophila_2:1630603_at:364:349; Interrogation_Position=2760; Antisense; GCAGTGCGCCAGGTCGGAGTTCTAT
>probe:Drosophila_2:1630603_at:213:429; Interrogation_Position=2776; Antisense; GAGTTCTATCGGCTACCCCAGTGGC
>probe:Drosophila_2:1630603_at:542:267; Interrogation_Position=2794; Antisense; CAGTGGCGACGCAACGAGCTGAAGC
>probe:Drosophila_2:1630603_at:169:613; Interrogation_Position=2813; Antisense; TGAAGCGGCGTGTGAAGCTCTTCTA
>probe:Drosophila_2:1630603_at:386:207; Interrogation_Position=2827; Antisense; AAGCTCTTCTAGGAGGCAAGTGGAA
>probe:Drosophila_2:1630603_at:484:115; Interrogation_Position=2857; Antisense; AGCATGCGAGGATAGCAACCCAAGT
>probe:Drosophila_2:1630603_at:71:437; Interrogation_Position=2886; Antisense; GAGGAGGCTGTTTGCGACGAAACCA
>probe:Drosophila_2:1630603_at:616:243; Interrogation_Position=2920; Antisense; AATTTACCTTAACAGCAGATGGCTA
>probe:Drosophila_2:1630603_at:89:441; Interrogation_Position=2937; Antisense; GATGGCTATAACTCACGTGGCAGGA
>probe:Drosophila_2:1630603_at:66:391; Interrogation_Position=2997; Antisense; GAAACTATGCTAATTTCACAGCCAG
>probe:Drosophila_2:1630603_at:199:667; Interrogation_Position=3093; Antisense; TACAGTGCGGAGCAACTAGCCGGCA
>probe:Drosophila_2:1630603_at:603:125; Interrogation_Position=3110; Antisense; AGCCGGCAGCTCCTGTTTATTTTTT

Paste this into a BLAST search page for me
GATGCTGCGCCATCTGTCGGACATCATTCGAACACATCTTGCAGTGCGCCGCAGTGCGCCAGGTCGGAGTTCTATGAGTTCTATCGGCTACCCCAGTGGCCAGTGGCGACGCAACGAGCTGAAGCTGAAGCGGCGTGTGAAGCTCTTCTAAAGCTCTTCTAGGAGGCAAGTGGAAAGCATGCGAGGATAGCAACCCAAGTGAGGAGGCTGTTTGCGACGAAACCAAATTTACCTTAACAGCAGATGGCTAGATGGCTATAACTCACGTGGCAGGAGAAACTATGCTAATTTCACAGCCAGTACAGTGCGGAGCAACTAGCCGGCAAGCCGGCAGCTCCTGTTTATTTTTT

Full Affymetrix probeset data:

Annotations for 1630603_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime