FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630605_at:

>probe:Drosophila_2:1630605_at:134:357; Interrogation_Position=1167; Antisense; GCACATATTCTGCAACGATTGTCAC
>probe:Drosophila_2:1630605_at:221:203; Interrogation_Position=1203; Antisense; AACCAAATTCCATTTCATCGGACTA
>probe:Drosophila_2:1630605_at:371:403; Interrogation_Position=1223; Antisense; GACTAAAGTGCGTCCATTGCGGCGC
>probe:Drosophila_2:1630605_at:9:333; Interrogation_Position=1241; Antisense; GCGGCGCCTACAATACAACGCAGGA
>probe:Drosophila_2:1630605_at:193:253; Interrogation_Position=1256; Antisense; CAACGCAGGATGTTAAACGCCGCCT
>probe:Drosophila_2:1630605_at:22:279; Interrogation_Position=1279; Antisense; CTGTCCCTGGTCACCGATGAACCAT
>probe:Drosophila_2:1630605_at:411:445; Interrogation_Position=1294; Antisense; GATGAACCATCCTCGGCGTGATATC
>probe:Drosophila_2:1630605_at:103:575; Interrogation_Position=1308; Antisense; GGCGTGATATCCACCCGATTCAAAC
>probe:Drosophila_2:1630605_at:530:347; Interrogation_Position=1343; Antisense; GCATCCGCATCTATATTCGCATCAG
>probe:Drosophila_2:1630605_at:169:175; Interrogation_Position=1369; Antisense; AACAGGAAACCTCTTGCCATGCTAC
>probe:Drosophila_2:1630605_at:87:673; Interrogation_Position=1391; Antisense; TACCCACACATCTGAGGACACTGAT
>probe:Drosophila_2:1630605_at:132:559; Interrogation_Position=1406; Antisense; GGACACTGATTTGTTAGCTCAAGAC
>probe:Drosophila_2:1630605_at:254:657; Interrogation_Position=1533; Antisense; TAAATATTGGTCTGGTCCCCTTAAG
>probe:Drosophila_2:1630605_at:466:39; Interrogation_Position=1648; Antisense; ATCTCCAGAGGATTTCAACGCACCA

Paste this into a BLAST search page for me
GCACATATTCTGCAACGATTGTCACAACCAAATTCCATTTCATCGGACTAGACTAAAGTGCGTCCATTGCGGCGCGCGGCGCCTACAATACAACGCAGGACAACGCAGGATGTTAAACGCCGCCTCTGTCCCTGGTCACCGATGAACCATGATGAACCATCCTCGGCGTGATATCGGCGTGATATCCACCCGATTCAAACGCATCCGCATCTATATTCGCATCAGAACAGGAAACCTCTTGCCATGCTACTACCCACACATCTGAGGACACTGATGGACACTGATTTGTTAGCTCAAGACTAAATATTGGTCTGGTCCCCTTAAGATCTCCAGAGGATTTCAACGCACCA

Full Affymetrix probeset data:

Annotations for 1630605_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720