FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630606_at:

>probe:Drosophila_2:1630606_at:480:401; Interrogation_Position=1579; Antisense; GACATCTTCTCCACGCACAAGGGTG
>probe:Drosophila_2:1630606_at:225:53; Interrogation_Position=1651; Antisense; ATGAATAATCCCCAGTTGCACGACG
>probe:Drosophila_2:1630606_at:306:473; Interrogation_Position=1675; Antisense; GTTAACCGGCGCACAGATGTCGTCT
>probe:Drosophila_2:1630606_at:464:99; Interrogation_Position=1689; Antisense; AGATGTCGTCTCCTACACGGTGCTG
>probe:Drosophila_2:1630606_at:31:419; Interrogation_Position=1717; Antisense; GAGCTGACCCACTTCAAGAGCGAGC
>probe:Drosophila_2:1630606_at:171:543; Interrogation_Position=1743; Antisense; GGATACGCATTTGAAGCATACGCTT
>probe:Drosophila_2:1630606_at:620:127; Interrogation_Position=1785; Antisense; ACAGATTAAGTTTTACCAGGGCGTG
>probe:Drosophila_2:1630606_at:175:77; Interrogation_Position=1823; Antisense; AGGAGGCCAGCCGTCAGATTGAGTA
>probe:Drosophila_2:1630606_at:670:463; Interrogation_Position=1839; Antisense; GATTGAGTAGATTGGCCCTTGGCCC
>probe:Drosophila_2:1630606_at:661:409; Interrogation_Position=1869; Antisense; GACGACGACTCATCGCTGAAGAGAT
>probe:Drosophila_2:1630606_at:729:419; Interrogation_Position=1904; Antisense; GAGCACAAAGAAACCGCACCGGGCA
>probe:Drosophila_2:1630606_at:99:527; Interrogation_Position=1924; Antisense; GGGCACACACTTCCACACAGAGATA
>probe:Drosophila_2:1630606_at:681:675; Interrogation_Position=1951; Antisense; TAGCTGAAAACATTCGCACGCGCGC
>probe:Drosophila_2:1630606_at:490:133; Interrogation_Position=1968; Antisense; ACGCGCGCATTTCAAATGCCTTCGA

Paste this into a BLAST search page for me
GACATCTTCTCCACGCACAAGGGTGATGAATAATCCCCAGTTGCACGACGGTTAACCGGCGCACAGATGTCGTCTAGATGTCGTCTCCTACACGGTGCTGGAGCTGACCCACTTCAAGAGCGAGCGGATACGCATTTGAAGCATACGCTTACAGATTAAGTTTTACCAGGGCGTGAGGAGGCCAGCCGTCAGATTGAGTAGATTGAGTAGATTGGCCCTTGGCCCGACGACGACTCATCGCTGAAGAGATGAGCACAAAGAAACCGCACCGGGCAGGGCACACACTTCCACACAGAGATATAGCTGAAAACATTCGCACGCGCGCACGCGCGCATTTCAAATGCCTTCGA

Full Affymetrix probeset data:

Annotations for 1630606_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720