Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630607_at:

>probe:Drosophila_2:1630607_at:422:391; Interrogation_Position=3127; Antisense; GAAACCCATACATTGGCTGGCTACA
>probe:Drosophila_2:1630607_at:211:333; Interrogation_Position=3142; Antisense; GCTGGCTACATTGAGCACTCGCTGT
>probe:Drosophila_2:1630607_at:40:599; Interrogation_Position=3164; Antisense; TGTCCATCTTCAATACCTCGGATTA
>probe:Drosophila_2:1630607_at:552:399; Interrogation_Position=3229; Antisense; GACACCTGCCAATATCGTGGCTATA
>probe:Drosophila_2:1630607_at:706:703; Interrogation_Position=3270; Antisense; TTACGAACCCTATGGACTGAGTCCC
>probe:Drosophila_2:1630607_at:124:609; Interrogation_Position=3287; Antisense; TGAGTCCCCATTACTGGCATGTCTT
>probe:Drosophila_2:1630607_at:387:569; Interrogation_Position=3324; Antisense; GGCTTTTGTGGTGGTTTTCGAGCAC
>probe:Drosophila_2:1630607_at:622:345; Interrogation_Position=3368; Antisense; GCATCATGCAGTTCATCATTCCGGA
>probe:Drosophila_2:1630607_at:352:135; Interrogation_Position=3392; Antisense; ACGTTCCATCCGAGGTGAAGACCCA
>probe:Drosophila_2:1630607_at:126:141; Interrogation_Position=3461; Antisense; ACGGCATCAAGCGTGCTCAGGGCGA
>probe:Drosophila_2:1630607_at:327:337; Interrogation_Position=3475; Antisense; GCTCAGGGCGACAGCCAGGACATTA
>probe:Drosophila_2:1630607_at:163:403; Interrogation_Position=3493; Antisense; GACATTATGAGCCTGTTCCGGGACA
>probe:Drosophila_2:1630607_at:679:609; Interrogation_Position=3590; Antisense; TGAGCGATGGACTGGACGCCCATGT
>probe:Drosophila_2:1630607_at:114:259; Interrogation_Position=3632; Antisense; CACGACGGTCTGTGGAATCCACGGT

Paste this into a BLAST search page for me
GAAACCCATACATTGGCTGGCTACAGCTGGCTACATTGAGCACTCGCTGTTGTCCATCTTCAATACCTCGGATTAGACACCTGCCAATATCGTGGCTATATTACGAACCCTATGGACTGAGTCCCTGAGTCCCCATTACTGGCATGTCTTGGCTTTTGTGGTGGTTTTCGAGCACGCATCATGCAGTTCATCATTCCGGAACGTTCCATCCGAGGTGAAGACCCAACGGCATCAAGCGTGCTCAGGGCGAGCTCAGGGCGACAGCCAGGACATTAGACATTATGAGCCTGTTCCGGGACATGAGCGATGGACTGGACGCCCATGTCACGACGGTCTGTGGAATCCACGGT

Full Affymetrix probeset data:

Annotations for 1630607_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime