FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630608_at:

>probe:Drosophila_2:1630608_at:99:529; Interrogation_Position=2748; Antisense; GGGAGGACATCTTCCGTAGCTACGA
>probe:Drosophila_2:1630608_at:248:485; Interrogation_Position=2763; Antisense; GTAGCTACGACATTCCCAGGGACGC
>probe:Drosophila_2:1630608_at:659:627; Interrogation_Position=2790; Antisense; TGCCTTCCAGTAGTGGGCTGCAGAG
>probe:Drosophila_2:1630608_at:299:31; Interrogation_Position=2823; Antisense; ATAAGTTGTTCGGTGGCCTCAACGA
>probe:Drosophila_2:1630608_at:579:353; Interrogation_Position=2860; Antisense; GCACCTGCGCAACGTCATGGCAAAA
>probe:Drosophila_2:1630608_at:129:175; Interrogation_Position=2882; Antisense; AAAGCGGAGCACGATCGCCAGGTAC
>probe:Drosophila_2:1630608_at:306:79; Interrogation_Position=2901; Antisense; AGGTACTAAGTCTGCTGCTGCTGCT
>probe:Drosophila_2:1630608_at:144:47; Interrogation_Position=2927; Antisense; ATCCAGACCTGCGATGACCACAATG
>probe:Drosophila_2:1630608_at:619:393; Interrogation_Position=2963; Antisense; GAAAGGAGCCGTAAGCACCTGCTAA
>probe:Drosophila_2:1630608_at:274:439; Interrogation_Position=3024; Antisense; GAGGCAAGACCTCCAGGCAGAGATT
>probe:Drosophila_2:1630608_at:599:537; Interrogation_Position=3134; Antisense; GGCTATACGACAACCACGGATCTGC
>probe:Drosophila_2:1630608_at:194:349; Interrogation_Position=3179; Antisense; GCAGGCAGCTACGAGGAGACCACCA
>probe:Drosophila_2:1630608_at:20:425; Interrogation_Position=3194; Antisense; GAGACCACCAAGTTCGAGATACGCG
>probe:Drosophila_2:1630608_at:282:219; Interrogation_Position=3299; Antisense; AAGTCATTATATTCGCTGGCGTCCA

Paste this into a BLAST search page for me
GGGAGGACATCTTCCGTAGCTACGAGTAGCTACGACATTCCCAGGGACGCTGCCTTCCAGTAGTGGGCTGCAGAGATAAGTTGTTCGGTGGCCTCAACGAGCACCTGCGCAACGTCATGGCAAAAAAAGCGGAGCACGATCGCCAGGTACAGGTACTAAGTCTGCTGCTGCTGCTATCCAGACCTGCGATGACCACAATGGAAAGGAGCCGTAAGCACCTGCTAAGAGGCAAGACCTCCAGGCAGAGATTGGCTATACGACAACCACGGATCTGCGCAGGCAGCTACGAGGAGACCACCAGAGACCACCAAGTTCGAGATACGCGAAGTCATTATATTCGCTGGCGTCCA

Full Affymetrix probeset data:

Annotations for 1630608_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720