Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630612_at:

>probe:Drosophila_2:1630612_at:299:539; Interrogation_Position=1191; Antisense; GGTACAGCACACATATCCGTTTTGG
>probe:Drosophila_2:1630612_at:318:513; Interrogation_Position=1225; Antisense; GTGATGCCATTTCAGTGACCAGTAC
>probe:Drosophila_2:1630612_at:537:607; Interrogation_Position=1276; Antisense; TGAGATCCCGGCAAACAGGCTTTAT
>probe:Drosophila_2:1630612_at:77:257; Interrogation_Position=1291; Antisense; CAGGCTTTATCCTCAACGACGAAAT
>probe:Drosophila_2:1630612_at:403:393; Interrogation_Position=1311; Antisense; GAAATGGACGACTTTAGTACGCCCG
>probe:Drosophila_2:1630612_at:527:495; Interrogation_Position=1366; Antisense; GTCCCGCAAACTTTATCAAACCAGG
>probe:Drosophila_2:1630612_at:472:181; Interrogation_Position=1391; Antisense; AAAACGGCCGATGTCCTCAACTTGT
>probe:Drosophila_2:1630612_at:498:189; Interrogation_Position=1409; Antisense; AACTTGTCCCAGCATCGTTTTAGAC
>probe:Drosophila_2:1630612_at:337:531; Interrogation_Position=1473; Antisense; GGGTCAAAAATCACCACCTCTGTTG
>probe:Drosophila_2:1630612_at:606:641; Interrogation_Position=1491; Antisense; TCTGTTGCCCAGACTATTCTAAGGT
>probe:Drosophila_2:1630612_at:637:477; Interrogation_Position=1514; Antisense; GTATTTTGTACTCCACGAACCTATT
>probe:Drosophila_2:1630612_at:177:11; Interrogation_Position=1552; Antisense; ATTCAGGACGTTTGCATCACCAACT
>probe:Drosophila_2:1630612_at:305:689; Interrogation_Position=1680; Antisense; TATTCAGCACAGACGGCCATTGGAA
>probe:Drosophila_2:1630612_at:478:133; Interrogation_Position=1723; Antisense; ACCCCGTCTGCGATCGGAGAAGAGT

Paste this into a BLAST search page for me
GGTACAGCACACATATCCGTTTTGGGTGATGCCATTTCAGTGACCAGTACTGAGATCCCGGCAAACAGGCTTTATCAGGCTTTATCCTCAACGACGAAATGAAATGGACGACTTTAGTACGCCCGGTCCCGCAAACTTTATCAAACCAGGAAAACGGCCGATGTCCTCAACTTGTAACTTGTCCCAGCATCGTTTTAGACGGGTCAAAAATCACCACCTCTGTTGTCTGTTGCCCAGACTATTCTAAGGTGTATTTTGTACTCCACGAACCTATTATTCAGGACGTTTGCATCACCAACTTATTCAGCACAGACGGCCATTGGAAACCCCGTCTGCGATCGGAGAAGAGT

Full Affymetrix probeset data:

Annotations for 1630612_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime