Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630617_at:

>probe:Drosophila_2:1630617_at:438:583; Interrogation_Position=3734; Antisense; TGGCATGTGTTTTCGCCATGGCGAC
>probe:Drosophila_2:1630617_at:263:521; Interrogation_Position=3770; Antisense; GTGGCACAAAGGACTCCAACTCGAG
>probe:Drosophila_2:1630617_at:492:75; Interrogation_Position=3793; Antisense; AGGACCCGGCTGTTGAACTGTTGAG
>probe:Drosophila_2:1630617_at:664:361; Interrogation_Position=3844; Antisense; GAATTCCGGCCGAAAATCGCGTAGT
>probe:Drosophila_2:1630617_at:698:233; Interrogation_Position=3858; Antisense; AATCGCGTAGTGTGCTCTAGTTTAT
>probe:Drosophila_2:1630617_at:568:611; Interrogation_Position=3882; Antisense; TGAAATTTTAATTCGGGCCACATCC
>probe:Drosophila_2:1630617_at:298:153; Interrogation_Position=3901; Antisense; ACATCCGCTCCAGAGTTGCATTTAA
>probe:Drosophila_2:1630617_at:662:243; Interrogation_Position=3928; Antisense; AATTTATCGCGTTTATTTTCCATAG
>probe:Drosophila_2:1630617_at:664:673; Interrogation_Position=4011; Antisense; TAGAATTTGATTGTCCCGCCTTAAG
>probe:Drosophila_2:1630617_at:590:501; Interrogation_Position=4023; Antisense; GTCCCGCCTTAAGTTTGTTGTATTG
>probe:Drosophila_2:1630617_at:152:651; Interrogation_Position=4061; Antisense; TCAACACGAGTGTTTCCGGGTATCG
>probe:Drosophila_2:1630617_at:510:455; Interrogation_Position=4143; Antisense; GATAACCCCGTTTGAGACTTGTATG
>probe:Drosophila_2:1630617_at:405:393; Interrogation_Position=4182; Antisense; GAAATCGTTTAAGCAGACCCCTAGC
>probe:Drosophila_2:1630617_at:272:515; Interrogation_Position=4236; Antisense; GTGTTCAAGACTTTTCCACTGTAAC

Paste this into a BLAST search page for me
TGGCATGTGTTTTCGCCATGGCGACGTGGCACAAAGGACTCCAACTCGAGAGGACCCGGCTGTTGAACTGTTGAGGAATTCCGGCCGAAAATCGCGTAGTAATCGCGTAGTGTGCTCTAGTTTATTGAAATTTTAATTCGGGCCACATCCACATCCGCTCCAGAGTTGCATTTAAAATTTATCGCGTTTATTTTCCATAGTAGAATTTGATTGTCCCGCCTTAAGGTCCCGCCTTAAGTTTGTTGTATTGTCAACACGAGTGTTTCCGGGTATCGGATAACCCCGTTTGAGACTTGTATGGAAATCGTTTAAGCAGACCCCTAGCGTGTTCAAGACTTTTCCACTGTAAC

Full Affymetrix probeset data:

Annotations for 1630617_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime