Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630618_at:

>probe:Drosophila_2:1630618_at:252:539; Interrogation_Position=2121; Antisense; GGTTACCCAATAAATCACTGCCTCC
>probe:Drosophila_2:1630618_at:411:131; Interrogation_Position=2185; Antisense; ACCCTGGTCGGAATCGGCGCAAAAG
>probe:Drosophila_2:1630618_at:202:39; Interrogation_Position=2197; Antisense; ATCGGCGCAAAAGGCTTCGTTGGAT
>probe:Drosophila_2:1630618_at:211:589; Interrogation_Position=2217; Antisense; TGGATAGTTTTGGATCCTCCCACGA
>probe:Drosophila_2:1630618_at:728:507; Interrogation_Position=2283; Antisense; GTGCTACACCGCATCAAAGTGGCTT
>probe:Drosophila_2:1630618_at:154:103; Interrogation_Position=2319; Antisense; AGACCATAGGACCTGCTTTCAGTTT
>probe:Drosophila_2:1630618_at:492:61; Interrogation_Position=2351; Antisense; ATGTCAGATCCTTTGGTACCGGTCA
>probe:Drosophila_2:1630618_at:156:487; Interrogation_Position=2366; Antisense; GTACCGGTCACGTACCAGCAGTGGC
>probe:Drosophila_2:1630618_at:489:195; Interrogation_Position=2395; Antisense; AACTGGTGACCATCATCAGCATCTT
>probe:Drosophila_2:1630618_at:452:37; Interrogation_Position=2415; Antisense; ATCTTTCGCAGCACTTAAGCCAGAG
>probe:Drosophila_2:1630618_at:222:199; Interrogation_Position=2474; Antisense; AACGAGCAGCTTCTACTTGGACAAC
>probe:Drosophila_2:1630618_at:529:355; Interrogation_Position=2524; Antisense; GCACTTAGCACTTCATCATGGACGT
>probe:Drosophila_2:1630618_at:638:517; Interrogation_Position=2585; Antisense; GTGGTAGTGCCACCGATACCCATTT
>probe:Drosophila_2:1630618_at:590:705; Interrogation_Position=2695; Antisense; TTAAGTTTCTGGCACGATTTCCAAA

Paste this into a BLAST search page for me
GGTTACCCAATAAATCACTGCCTCCACCCTGGTCGGAATCGGCGCAAAAGATCGGCGCAAAAGGCTTCGTTGGATTGGATAGTTTTGGATCCTCCCACGAGTGCTACACCGCATCAAAGTGGCTTAGACCATAGGACCTGCTTTCAGTTTATGTCAGATCCTTTGGTACCGGTCAGTACCGGTCACGTACCAGCAGTGGCAACTGGTGACCATCATCAGCATCTTATCTTTCGCAGCACTTAAGCCAGAGAACGAGCAGCTTCTACTTGGACAACGCACTTAGCACTTCATCATGGACGTGTGGTAGTGCCACCGATACCCATTTTTAAGTTTCTGGCACGATTTCCAAA

Full Affymetrix probeset data:

Annotations for 1630618_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime