FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630619_at:

>probe:Drosophila_2:1630619_at:561:217; Interrogation_Position=1004; Antisense; AAGTCATCGAGCTGCCGTACCTTAA
>probe:Drosophila_2:1630619_at:46:709; Interrogation_Position=1025; Antisense; TTAACTCCAACCTGTCCATGACTAT
>probe:Drosophila_2:1630619_at:506:55; Interrogation_Position=1042; Antisense; ATGACTATCTTTCTGCCCCGAGAAG
>probe:Drosophila_2:1630619_at:218:77; Interrogation_Position=1127; Antisense; AGGAGGTCTATCTTAAGCTGCCCAA
>probe:Drosophila_2:1630619_at:664:45; Interrogation_Position=1204; Antisense; ATCCGAGAGCTATTCACCGACAAGT
>probe:Drosophila_2:1630619_at:270:403; Interrogation_Position=1231; Antisense; GACTTAAGCGGCTTGTTCGCCGATA
>probe:Drosophila_2:1630619_at:456:171; Interrogation_Position=1267; Antisense; AAAGTCAGTCAGGTCTCGCACAAGG
>probe:Drosophila_2:1630619_at:301:581; Interrogation_Position=1343; Antisense; TGGCCGTCACAAATCGAGCGGGATT
>probe:Drosophila_2:1630619_at:481:417; Interrogation_Position=1358; Antisense; GAGCGGGATTTTCTACGTTCCTCAT
>probe:Drosophila_2:1630619_at:115:693; Interrogation_Position=1396; Antisense; TTTGCCTTCGTCATTCGCGATGCGA
>probe:Drosophila_2:1630619_at:530:445; Interrogation_Position=1414; Antisense; GATGCGAACACCATATATTTCCAGG
>probe:Drosophila_2:1630619_at:362:385; Interrogation_Position=927; Antisense; GAACAAGAGTGTGCCCGTCCAGATG
>probe:Drosophila_2:1630619_at:716:7; Interrogation_Position=969; Antisense; ATTCAGGGCTAACTACTTCCGCGAT
>probe:Drosophila_2:1630619_at:637:717; Interrogation_Position=985; Antisense; TTCCGCGATCTAGATGCCCAAGTCA

Paste this into a BLAST search page for me
AAGTCATCGAGCTGCCGTACCTTAATTAACTCCAACCTGTCCATGACTATATGACTATCTTTCTGCCCCGAGAAGAGGAGGTCTATCTTAAGCTGCCCAAATCCGAGAGCTATTCACCGACAAGTGACTTAAGCGGCTTGTTCGCCGATAAAAGTCAGTCAGGTCTCGCACAAGGTGGCCGTCACAAATCGAGCGGGATTGAGCGGGATTTTCTACGTTCCTCATTTTGCCTTCGTCATTCGCGATGCGAGATGCGAACACCATATATTTCCAGGGAACAAGAGTGTGCCCGTCCAGATGATTCAGGGCTAACTACTTCCGCGATTTCCGCGATCTAGATGCCCAAGTCA

Full Affymetrix probeset data:

Annotations for 1630619_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720