FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630620_at:

>probe:Drosophila_2:1630620_at:399:167; Interrogation_Position=1073; Antisense; AAACGGATCTGATACTCGTTCCCTC
>probe:Drosophila_2:1630620_at:682:95; Interrogation_Position=1104; Antisense; AGATCCCACGGCACCTAATATTCTG
>probe:Drosophila_2:1630620_at:18:441; Interrogation_Position=1257; Antisense; GATGGCCAAGTTTTGTCGCAACACC
>probe:Drosophila_2:1630620_at:185:359; Interrogation_Position=1274; Antisense; GCAACACCTTGCATTTTCCTGAAGA
>probe:Drosophila_2:1630620_at:704:139; Interrogation_Position=1300; Antisense; ACGTCCCAGATCGAGCAGCATTTTG
>probe:Drosophila_2:1630620_at:540:107; Interrogation_Position=1327; Antisense; AGAACGATTGTGTGCCAGGGTCATT
>probe:Drosophila_2:1630620_at:253:21; Interrogation_Position=1349; Antisense; ATTTGGTGCCCATTCATCCGATTGC
>probe:Drosophila_2:1630620_at:41:87; Interrogation_Position=1380; Antisense; AGTGCACTGGGACTACGATCCTGCT
>probe:Drosophila_2:1630620_at:400:629; Interrogation_Position=1416; Antisense; TCCACTGCCGGATCTGATTGTCATG
>probe:Drosophila_2:1630620_at:85:63; Interrogation_Position=1438; Antisense; ATGGGCGATTCGTGTCAGAGCTTTA
>probe:Drosophila_2:1630620_at:90:189; Interrogation_Position=1472; Antisense; AACATGGCTGCACTGTTCTCAATAC
>probe:Drosophila_2:1630620_at:3:655; Interrogation_Position=1490; Antisense; TCAATACCGGCTCCTTTGTCAAGTC
>probe:Drosophila_2:1630620_at:270:495; Interrogation_Position=1507; Antisense; GTCAAGTCCAAGTTCGCATTCAAAG
>probe:Drosophila_2:1630620_at:288:221; Interrogation_Position=1529; Antisense; AAGTGTATATACCAGCGACGCGAAC

Paste this into a BLAST search page for me
AAACGGATCTGATACTCGTTCCCTCAGATCCCACGGCACCTAATATTCTGGATGGCCAAGTTTTGTCGCAACACCGCAACACCTTGCATTTTCCTGAAGAACGTCCCAGATCGAGCAGCATTTTGAGAACGATTGTGTGCCAGGGTCATTATTTGGTGCCCATTCATCCGATTGCAGTGCACTGGGACTACGATCCTGCTTCCACTGCCGGATCTGATTGTCATGATGGGCGATTCGTGTCAGAGCTTTAAACATGGCTGCACTGTTCTCAATACTCAATACCGGCTCCTTTGTCAAGTCGTCAAGTCCAAGTTCGCATTCAAAGAAGTGTATATACCAGCGACGCGAAC

Full Affymetrix probeset data:

Annotations for 1630620_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720