FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630621_at:

>probe:Drosophila_2:1630621_at:532:273; Interrogation_Position=117; Antisense; CATTTCTGCCGTGCCCGTGGATGAG
>probe:Drosophila_2:1630621_at:259:445; Interrogation_Position=136; Antisense; GATGAGTCCCTGATCGGCGATAATA
>probe:Drosophila_2:1630621_at:512:327; Interrogation_Position=152; Antisense; GCGATAATATCTACCAGCCTGCCTT
>probe:Drosophila_2:1630621_at:76:127; Interrogation_Position=167; Antisense; AGCCTGCCTTCGACGATGTCCAGCG
>probe:Drosophila_2:1630621_at:95:281; Interrogation_Position=232; Antisense; CTCAAGTTGAAGAAGCTCCTGGGTT
>probe:Drosophila_2:1630621_at:239:247; Interrogation_Position=263; Antisense; AATTCGCAATAAGCTTCGTTCAGAT
>probe:Drosophila_2:1630621_at:546:637; Interrogation_Position=278; Antisense; TCGTTCAGATTCTAGTCCAGCCAAT
>probe:Drosophila_2:1630621_at:686:85; Interrogation_Position=291; Antisense; AGTCCAGCCAATTGGGAACCTTGCC
>probe:Drosophila_2:1630621_at:57:711; Interrogation_Position=31; Antisense; TTAATCAGCGTAATCATCTCCCCAG
>probe:Drosophila_2:1630621_at:710:665; Interrogation_Position=324; Antisense; TACATTCGATTTTCAAACCGTTTTG
>probe:Drosophila_2:1630621_at:16:479; Interrogation_Position=348; Antisense; GTTTAGACAATACCCAATAAGCACA
>probe:Drosophila_2:1630621_at:663:113; Interrogation_Position=54; Antisense; AGCAGCAGCAATCATGAAGTACCTA
>probe:Drosophila_2:1630621_at:275:601; Interrogation_Position=68; Antisense; TGAAGTACCTAGCTCTGACCATTTT
>probe:Drosophila_2:1630621_at:587:125; Interrogation_Position=85; Antisense; ACCATTTTCGTGTGCCTTATGGCCA

Paste this into a BLAST search page for me
CATTTCTGCCGTGCCCGTGGATGAGGATGAGTCCCTGATCGGCGATAATAGCGATAATATCTACCAGCCTGCCTTAGCCTGCCTTCGACGATGTCCAGCGCTCAAGTTGAAGAAGCTCCTGGGTTAATTCGCAATAAGCTTCGTTCAGATTCGTTCAGATTCTAGTCCAGCCAATAGTCCAGCCAATTGGGAACCTTGCCTTAATCAGCGTAATCATCTCCCCAGTACATTCGATTTTCAAACCGTTTTGGTTTAGACAATACCCAATAAGCACAAGCAGCAGCAATCATGAAGTACCTATGAAGTACCTAGCTCTGACCATTTTACCATTTTCGTGTGCCTTATGGCCA

Full Affymetrix probeset data:

Annotations for 1630621_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720