FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630622_at:

>probe:Drosophila_2:1630622_at:406:91; Interrogation_Position=392; Antisense; AGTATCTTTCCGAATTGCACGGCAA
>probe:Drosophila_2:1630622_at:154:355; Interrogation_Position=408; Antisense; GCACGGCAACATTTACATCGAACAG
>probe:Drosophila_2:1630622_at:438:405; Interrogation_Position=446; Antisense; GACGGCAATTTGTGAGCCCATCTGC
>probe:Drosophila_2:1630622_at:647:537; Interrogation_Position=484; Antisense; GGTCAAAAATCCCTGCAACGTGCCT
>probe:Drosophila_2:1630622_at:433:197; Interrogation_Position=500; Antisense; AACGTGCCTGCAAGTCTTCAATGGA
>probe:Drosophila_2:1630622_at:672:293; Interrogation_Position=561; Antisense; CGATAACGTTCTGGACTGGGAGCAC
>probe:Drosophila_2:1630622_at:358:553; Interrogation_Position=579; Antisense; GGAGCACGATCTTCCCGAAAACGAC
>probe:Drosophila_2:1630622_at:333:169; Interrogation_Position=608; Antisense; AAATGGGTGTGATGCACTCCACCGT
>probe:Drosophila_2:1630622_at:19:333; Interrogation_Position=634; Antisense; GCTGACCTAAATATTGCGCTTGGAA
>probe:Drosophila_2:1630622_at:184:299; Interrogation_Position=650; Antisense; CGCTTGGAACCACTTTGCAGATCGT
>probe:Drosophila_2:1630622_at:576:693; Interrogation_Position=663; Antisense; TTTGCAGATCGTTCCCAGCGGAGAC
>probe:Drosophila_2:1630622_at:688:257; Interrogation_Position=678; Antisense; CAGCGGAGACCTTCCTTTAAAGAAT
>probe:Drosophila_2:1630622_at:676:725; Interrogation_Position=722; Antisense; TTGTCATTTGTAATCTGCAGCCCAC
>probe:Drosophila_2:1630622_at:476:717; Interrogation_Position=852; Antisense; TTCCGATCCTACAAAGCAGTCCAAG

Paste this into a BLAST search page for me
AGTATCTTTCCGAATTGCACGGCAAGCACGGCAACATTTACATCGAACAGGACGGCAATTTGTGAGCCCATCTGCGGTCAAAAATCCCTGCAACGTGCCTAACGTGCCTGCAAGTCTTCAATGGACGATAACGTTCTGGACTGGGAGCACGGAGCACGATCTTCCCGAAAACGACAAATGGGTGTGATGCACTCCACCGTGCTGACCTAAATATTGCGCTTGGAACGCTTGGAACCACTTTGCAGATCGTTTTGCAGATCGTTCCCAGCGGAGACCAGCGGAGACCTTCCTTTAAAGAATTTGTCATTTGTAATCTGCAGCCCACTTCCGATCCTACAAAGCAGTCCAAG

Full Affymetrix probeset data:

Annotations for 1630622_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720