Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630625_s_at:

>probe:Drosophila_2:1630625_s_at:471:593; Interrogation_Position=1015; Antisense; TGGGAGCAGGGAGCATTTTCTTATA
>probe:Drosophila_2:1630625_s_at:485:645; Interrogation_Position=1033; Antisense; TCTTATATTTGCAGGAGCCCGGCGA
>probe:Drosophila_2:1630625_s_at:156:425; Interrogation_Position=1069; Antisense; GAGACCAGTGCAGTCGGAGCTGATT
>probe:Drosophila_2:1630625_s_at:148:347; Interrogation_Position=695; Antisense; GCATCAGCCTGATCAACTTCTGGAT
>probe:Drosophila_2:1630625_s_at:100:191; Interrogation_Position=724; Antisense; AACATCCTCAGGCAGTCCAATATGC
>probe:Drosophila_2:1630625_s_at:521:561; Interrogation_Position=752; Antisense; GGAACTGTCCACTCAGGGAGGGCAA
>probe:Drosophila_2:1630625_s_at:468:147; Interrogation_Position=779; Antisense; ACTATATGCGCAACATTCGATCGGA
>probe:Drosophila_2:1630625_s_at:51:551; Interrogation_Position=807; Antisense; GGAGACTATTCCACGGTTCATTCGC
>probe:Drosophila_2:1630625_s_at:155:585; Interrogation_Position=834; Antisense; TGGCAGCTTTCGCATAGACTCTAGT
>probe:Drosophila_2:1630625_s_at:726:389; Interrogation_Position=895; Antisense; GAAACAATCTTCTACGTCGACATAA
>probe:Drosophila_2:1630625_s_at:659:161; Interrogation_Position=920; Antisense; AAATGAAGTCCTCTCGACACGTTCG
>probe:Drosophila_2:1630625_s_at:595:443; Interrogation_Position=959; Antisense; GATGCCACGGGTACTTTTTCGTCGT
>probe:Drosophila_2:1630625_s_at:437:699; Interrogation_Position=974; Antisense; TTTTCGTCGTATTTCCCATCAATTG
>probe:Drosophila_2:1630625_s_at:661:271; Interrogation_Position=990; Antisense; CATCAATTGCACTTCCGGAATGGAG

Paste this into a BLAST search page for me
TGGGAGCAGGGAGCATTTTCTTATATCTTATATTTGCAGGAGCCCGGCGAGAGACCAGTGCAGTCGGAGCTGATTGCATCAGCCTGATCAACTTCTGGATAACATCCTCAGGCAGTCCAATATGCGGAACTGTCCACTCAGGGAGGGCAAACTATATGCGCAACATTCGATCGGAGGAGACTATTCCACGGTTCATTCGCTGGCAGCTTTCGCATAGACTCTAGTGAAACAATCTTCTACGTCGACATAAAAATGAAGTCCTCTCGACACGTTCGGATGCCACGGGTACTTTTTCGTCGTTTTTCGTCGTATTTCCCATCAATTGCATCAATTGCACTTCCGGAATGGAG

Full Affymetrix probeset data:

Annotations for 1630625_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime