Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630626_at:

>probe:Drosophila_2:1630626_at:88:449; Interrogation_Position=5482; Antisense; GATGCCATTATCAAGGCGCCCATTG
>probe:Drosophila_2:1630626_at:273:577; Interrogation_Position=5496; Antisense; GGCGCCCATTGCTAAGCTGCAGAAA
>probe:Drosophila_2:1630626_at:215:177; Interrogation_Position=5519; Antisense; AAACTGCCCCGAAGGTGGTGCCACA
>probe:Drosophila_2:1630626_at:637:219; Interrogation_Position=5610; Antisense; AAGTGCTCCGCAAAGGCCGAACGAT
>probe:Drosophila_2:1630626_at:369:159; Interrogation_Position=5687; Antisense; AAATTGCCGGCCTGCTTAAAGTGGA
>probe:Drosophila_2:1630626_at:61:171; Interrogation_Position=5704; Antisense; AAAGTGGAGCCCACAGGATCCGCGT
>probe:Drosophila_2:1630626_at:717:647; Interrogation_Position=5731; Antisense; TCATCCAATGTGCTAGCCGCCATAT
>probe:Drosophila_2:1630626_at:380:315; Interrogation_Position=5749; Antisense; GCCATATCAATACCCGCAAATCTTT
>probe:Drosophila_2:1630626_at:463:37; Interrogation_Position=5768; Antisense; ATCTTTCAAAGATCCTGGCCAGCAT
>probe:Drosophila_2:1630626_at:590:559; Interrogation_Position=5796; Antisense; GGACAAGACTAATCTGCCTTCCAGT
>probe:Drosophila_2:1630626_at:291:133; Interrogation_Position=5863; Antisense; ACCGCAACCAGTTCATTTGCATCGA
>probe:Drosophila_2:1630626_at:2:113; Interrogation_Position=5899; Antisense; AGCAAAGGCCGTTTGGCGCATCTAA
>probe:Drosophila_2:1630626_at:503:413; Interrogation_Position=5932; Antisense; GAGCTTCTTAGCATGGTGCCGGACA
>probe:Drosophila_2:1630626_at:78:71; Interrogation_Position=5964; Antisense; AGGCGTGATTCCCAGATCGTCTAGG

Paste this into a BLAST search page for me
GATGCCATTATCAAGGCGCCCATTGGGCGCCCATTGCTAAGCTGCAGAAAAAACTGCCCCGAAGGTGGTGCCACAAAGTGCTCCGCAAAGGCCGAACGATAAATTGCCGGCCTGCTTAAAGTGGAAAAGTGGAGCCCACAGGATCCGCGTTCATCCAATGTGCTAGCCGCCATATGCCATATCAATACCCGCAAATCTTTATCTTTCAAAGATCCTGGCCAGCATGGACAAGACTAATCTGCCTTCCAGTACCGCAACCAGTTCATTTGCATCGAAGCAAAGGCCGTTTGGCGCATCTAAGAGCTTCTTAGCATGGTGCCGGACAAGGCGTGATTCCCAGATCGTCTAGG

Full Affymetrix probeset data:

Annotations for 1630626_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime