FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630629_at:

>probe:Drosophila_2:1630629_at:152:479; Interrogation_Position=114; Antisense; GTTTCGATTCGAACCGTATTCCAGT
>probe:Drosophila_2:1630629_at:515:721; Interrogation_Position=132; Antisense; TTCCAGTCCGCCCAGATGGATATGA
>probe:Drosophila_2:1630629_at:187:109; Interrogation_Position=169; Antisense; AGAAGGACCACTCGTTCGACAAGCG
>probe:Drosophila_2:1630629_at:441:135; Interrogation_Position=267; Antisense; ACGCGTTACGCGGAGCTGGACAAGA
>probe:Drosophila_2:1630629_at:16:155; Interrogation_Position=318; Antisense; ACAGTGGGCCAGTTCTACTTTCTCA
>probe:Drosophila_2:1630629_at:294:359; Interrogation_Position=346; Antisense; GCAAGCGTATCAATCTGCGTCCCGA
>probe:Drosophila_2:1630629_at:115:301; Interrogation_Position=376; Antisense; CCCTCTTCTTCTTCGTAAACAATGT
>probe:Drosophila_2:1630629_at:325:663; Interrogation_Position=391; Antisense; TAAACAATGTGATCCCACCGACATC
>probe:Drosophila_2:1630629_at:714:415; Interrogation_Position=441; Antisense; GAGCACTTCGACAAGGACTACTTCC
>probe:Drosophila_2:1630629_at:181:629; Interrogation_Position=463; Antisense; TCCTCTACATTTCCTATACCGATGA
>probe:Drosophila_2:1630629_at:326:193; Interrogation_Position=48; Antisense; AACTCAGGCCGGCAGCTACATAAGA
>probe:Drosophila_2:1630629_at:333:343; Interrogation_Position=516; Antisense; GCTTGACTCGCGTAATCGTTTTGGC
>probe:Drosophila_2:1630629_at:107:585; Interrogation_Position=575; Antisense; TGGCACTACTCGCTCAATAAAGAAT
>probe:Drosophila_2:1630629_at:349:173; Interrogation_Position=593; Antisense; AAAGAATGACTGCTCCTAGCCAGCT

Paste this into a BLAST search page for me
GTTTCGATTCGAACCGTATTCCAGTTTCCAGTCCGCCCAGATGGATATGAAGAAGGACCACTCGTTCGACAAGCGACGCGTTACGCGGAGCTGGACAAGAACAGTGGGCCAGTTCTACTTTCTCAGCAAGCGTATCAATCTGCGTCCCGACCCTCTTCTTCTTCGTAAACAATGTTAAACAATGTGATCCCACCGACATCGAGCACTTCGACAAGGACTACTTCCTCCTCTACATTTCCTATACCGATGAAACTCAGGCCGGCAGCTACATAAGAGCTTGACTCGCGTAATCGTTTTGGCTGGCACTACTCGCTCAATAAAGAATAAAGAATGACTGCTCCTAGCCAGCT

Full Affymetrix probeset data:

Annotations for 1630629_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720