FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630630_at:

>probe:Drosophila_2:1630630_at:673:155; Interrogation_Position=1780; Antisense; ACAGCATTTACTTGACCGTGGGCGA
>probe:Drosophila_2:1630630_at:510:563; Interrogation_Position=1813; Antisense; TGTCCAACTCCTTCGAGTGGTTAGT
>probe:Drosophila_2:1630630_at:637:395; Interrogation_Position=1908; Antisense; GAAATCATCCATCAGTTCCGAGTGC
>probe:Drosophila_2:1630630_at:658:301; Interrogation_Position=1948; Antisense; CCCGCATTGTTTCTGATATCTTCAC
>probe:Drosophila_2:1630630_at:112:23; Interrogation_Position=1963; Antisense; ATATCTTCACCGGACTGTGCATAAC
>probe:Drosophila_2:1630630_at:329:231; Interrogation_Position=2031; Antisense; AATGTATCTAACCTGACGCTGGCAC
>probe:Drosophila_2:1630630_at:422:671; Interrogation_Position=2060; Antisense; TACGATCGGGTTTCATCTGGGTTTC
>probe:Drosophila_2:1630630_at:306:11; Interrogation_Position=2091; Antisense; ATTCTGGTGCTGTTCTTCGTGTTCT
>probe:Drosophila_2:1630630_at:250:343; Interrogation_Position=2123; Antisense; GCTTAACATGTTCCAGACACTGCGC
>probe:Drosophila_2:1630630_at:143:605; Interrogation_Position=2152; Antisense; TGATTCCCATCGCAGTATTCACATT
>probe:Drosophila_2:1630630_at:531:91; Interrogation_Position=2165; Antisense; AGTATTCACATTCCTGGCTGGCAAC
>probe:Drosophila_2:1630630_at:6:567; Interrogation_Position=2184; Antisense; GGCAACCGATTACTGAGACGTCTTT
>probe:Drosophila_2:1630630_at:534:507; Interrogation_Position=2233; Antisense; GTGCGTCGTAAGTGCGTTCATCATT
>probe:Drosophila_2:1630630_at:225:85; Interrogation_Position=2272; Antisense; AGTGAGCTACTCTCTATCTTGCAAC

Paste this into a BLAST search page for me
ACAGCATTTACTTGACCGTGGGCGATGTCCAACTCCTTCGAGTGGTTAGTGAAATCATCCATCAGTTCCGAGTGCCCCGCATTGTTTCTGATATCTTCACATATCTTCACCGGACTGTGCATAACAATGTATCTAACCTGACGCTGGCACTACGATCGGGTTTCATCTGGGTTTCATTCTGGTGCTGTTCTTCGTGTTCTGCTTAACATGTTCCAGACACTGCGCTGATTCCCATCGCAGTATTCACATTAGTATTCACATTCCTGGCTGGCAACGGCAACCGATTACTGAGACGTCTTTGTGCGTCGTAAGTGCGTTCATCATTAGTGAGCTACTCTCTATCTTGCAAC

Full Affymetrix probeset data:

Annotations for 1630630_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720