FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630631_at:

>probe:Drosophila_2:1630631_at:529:545; Interrogation_Position=2031; Antisense; GGATCTGCGCCAGGAACTGTTACAA
>probe:Drosophila_2:1630631_at:158:73; Interrogation_Position=2075; Antisense; AGGAACGAATCAAGGCGCGTGCCCT
>probe:Drosophila_2:1630631_at:270:55; Interrogation_Position=2122; Antisense; ATGAATGTGCATCGGTGGCGTCTCC
>probe:Drosophila_2:1630631_at:331:181; Interrogation_Position=2166; Antisense; AAAAATGGACCTGCTCGGACGCATT
>probe:Drosophila_2:1630631_at:101:345; Interrogation_Position=2186; Antisense; GCATTAGCATCCTCCGAAAGCAGTT
>probe:Drosophila_2:1630631_at:680:93; Interrogation_Position=2207; Antisense; AGTTGCTCCAGCAGAACGTTGCCGC
>probe:Drosophila_2:1630631_at:366:231; Interrogation_Position=2254; Antisense; AATGAAGCCCAACAGCTCTATGCGG
>probe:Drosophila_2:1630631_at:449:279; Interrogation_Position=2269; Antisense; CTCTATGCGGCCTTGAGGGAGTTCA
>probe:Drosophila_2:1630631_at:229:623; Interrogation_Position=2318; Antisense; TGCGGGCGGAGCTCAACAGCGTTAA
>probe:Drosophila_2:1630631_at:708:633; Interrogation_Position=2340; Antisense; TAAGGCTAACCTATCCGCCAAGGAT
>probe:Drosophila_2:1630631_at:2:373; Interrogation_Position=2373; Antisense; GAAGGTCCTAAAGGCCGAGCTCAGT
>probe:Drosophila_2:1630631_at:579:49; Interrogation_Position=2443; Antisense; ATGCGGGTGAGTTTGGCTCTAACCA
>probe:Drosophila_2:1630631_at:720:551; Interrogation_Position=2529; Antisense; GGAGCAGATGCATTGCTACTCCGCG
>probe:Drosophila_2:1630631_at:190:279; Interrogation_Position=2567; Antisense; CTAGGACTCTGGGTGCGGGTTTCAA

Paste this into a BLAST search page for me
GGATCTGCGCCAGGAACTGTTACAAAGGAACGAATCAAGGCGCGTGCCCTATGAATGTGCATCGGTGGCGTCTCCAAAAATGGACCTGCTCGGACGCATTGCATTAGCATCCTCCGAAAGCAGTTAGTTGCTCCAGCAGAACGTTGCCGCAATGAAGCCCAACAGCTCTATGCGGCTCTATGCGGCCTTGAGGGAGTTCATGCGGGCGGAGCTCAACAGCGTTAATAAGGCTAACCTATCCGCCAAGGATGAAGGTCCTAAAGGCCGAGCTCAGTATGCGGGTGAGTTTGGCTCTAACCAGGAGCAGATGCATTGCTACTCCGCGCTAGGACTCTGGGTGCGGGTTTCAA

Full Affymetrix probeset data:

Annotations for 1630631_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720