FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630633_at:

>probe:Drosophila_2:1630633_at:470:215; Interrogation_Position=182; Antisense; AAGTTTCCAAAATATGCTCAGTGCA
>probe:Drosophila_2:1630633_at:93:155; Interrogation_Position=228; Antisense; ACAGAGGTCCTGTCAACCTGTTGGT
>probe:Drosophila_2:1630633_at:664:129; Interrogation_Position=243; Antisense; ACCTGTTGGTTTTACCGCCATACAT
>probe:Drosophila_2:1630633_at:411:57; Interrogation_Position=266; Antisense; ATGAGTAATGCCTCGTACTCACCAC
>probe:Drosophila_2:1630633_at:179:261; Interrogation_Position=288; Antisense; CACCCATTCGGCAGCATAATCATAA
>probe:Drosophila_2:1630633_at:277:473; Interrogation_Position=327; Antisense; GTTAATTGCGCAGCACTGATCAATA
>probe:Drosophila_2:1630633_at:119:187; Interrogation_Position=351; Antisense; AACACAGATTCCAGATTCCCGGGAC
>probe:Drosophila_2:1630633_at:562:717; Interrogation_Position=366; Antisense; TTCCCGGGACCCAAAGATGATGATG
>probe:Drosophila_2:1630633_at:101:523; Interrogation_Position=455; Antisense; GGGCCTGGGAGCAGCTTTCATTGAA
>probe:Drosophila_2:1630633_at:173:345; Interrogation_Position=481; Antisense; GCATTTCCCTTTTTCGACACATTAA
>probe:Drosophila_2:1630633_at:100:57; Interrogation_Position=551; Antisense; ATGAGTTGGGCATGCCACTTTTGTG
>probe:Drosophila_2:1630633_at:19:311; Interrogation_Position=564; Antisense; GCCACTTTTGTGGTTAACTCGGTGT
>probe:Drosophila_2:1630633_at:331:177; Interrogation_Position=598; Antisense; AAACTGATTTCGATCCCAGGACCAT
>probe:Drosophila_2:1630633_at:183:555; Interrogation_Position=616; Antisense; GGACCATCACACTGGAATTCGCCAA

Paste this into a BLAST search page for me
AAGTTTCCAAAATATGCTCAGTGCAACAGAGGTCCTGTCAACCTGTTGGTACCTGTTGGTTTTACCGCCATACATATGAGTAATGCCTCGTACTCACCACCACCCATTCGGCAGCATAATCATAAGTTAATTGCGCAGCACTGATCAATAAACACAGATTCCAGATTCCCGGGACTTCCCGGGACCCAAAGATGATGATGGGGCCTGGGAGCAGCTTTCATTGAAGCATTTCCCTTTTTCGACACATTAAATGAGTTGGGCATGCCACTTTTGTGGCCACTTTTGTGGTTAACTCGGTGTAAACTGATTTCGATCCCAGGACCATGGACCATCACACTGGAATTCGCCAA

Full Affymetrix probeset data:

Annotations for 1630633_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720