Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630634_s_at:

>probe:Drosophila_2:1630634_s_at:14:379; Interrogation_Position=235; Antisense; GAAGCGCAGCTTCAAGCACTTGGCT
>probe:Drosophila_2:1630634_s_at:549:209; Interrogation_Position=248; Antisense; AAGCACTTGGCTCTGGACATGTACA
>probe:Drosophila_2:1630634_s_at:256:559; Interrogation_Position=262; Antisense; GGACATGTACATGCCCGACAAGCGC
>probe:Drosophila_2:1630634_s_at:86:305; Interrogation_Position=342; Antisense; CCGTCTGCAGTCACATCGAGAACAT
>probe:Drosophila_2:1630634_s_at:664:549; Interrogation_Position=374; Antisense; GGAGTCACGTTTGGATTCCAGTACA
>probe:Drosophila_2:1630634_s_at:344:161; Interrogation_Position=396; Antisense; ACAAGATGCGTGCTGTGTACGCCCA
>probe:Drosophila_2:1630634_s_at:310:653; Interrogation_Position=429; Antisense; TCAACTGTGTCACCTCCGAGAACAA
>probe:Drosophila_2:1630634_s_at:212:427; Interrogation_Position=464; Antisense; GAGATCCGTAACTTCTTGGGTGAGA
>probe:Drosophila_2:1630634_s_at:456:727; Interrogation_Position=479; Antisense; TTGGGTGAGAAGTACATCCGTCGTG
>probe:Drosophila_2:1630634_s_at:144:21; Interrogation_Position=576; Antisense; ATATTGAGTCTGTCTCCGGATCTGC
>probe:Drosophila_2:1630634_s_at:599:113; Interrogation_Position=612; Antisense; AGCAGTCCACGACCGTCAAGAACAA
>probe:Drosophila_2:1630634_s_at:245:493; Interrogation_Position=645; Antisense; GTAAGTTCCTTGACGGTCTGTACGT
>probe:Drosophila_2:1630634_s_at:621:407; Interrogation_Position=656; Antisense; GACGGTCTGTACGTGTCCGAGAAGA
>probe:Drosophila_2:1630634_s_at:195:211; Interrogation_Position=677; Antisense; AAGACGACCGTTGTGAAGCTAGAGT

Paste this into a BLAST search page for me
GAAGCGCAGCTTCAAGCACTTGGCTAAGCACTTGGCTCTGGACATGTACAGGACATGTACATGCCCGACAAGCGCCCGTCTGCAGTCACATCGAGAACATGGAGTCACGTTTGGATTCCAGTACAACAAGATGCGTGCTGTGTACGCCCATCAACTGTGTCACCTCCGAGAACAAGAGATCCGTAACTTCTTGGGTGAGATTGGGTGAGAAGTACATCCGTCGTGATATTGAGTCTGTCTCCGGATCTGCAGCAGTCCACGACCGTCAAGAACAAGTAAGTTCCTTGACGGTCTGTACGTGACGGTCTGTACGTGTCCGAGAAGAAAGACGACCGTTGTGAAGCTAGAGT

Full Affymetrix probeset data:

Annotations for 1630634_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime