Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630638_at:

>probe:Drosophila_2:1630638_at:153:429; Interrogation_Position=3251; Antisense; GAGTTCAAAGCACAGTCGCCGCGAC
>probe:Drosophila_2:1630638_at:80:437; Interrogation_Position=3279; Antisense; GAGGAGGCTCGATCGTCGTCGCACA
>probe:Drosophila_2:1630638_at:40:333; Interrogation_Position=3285; Antisense; GCTCGATCGTCGTCGCACAGTAAAA
>probe:Drosophila_2:1630638_at:86:451; Interrogation_Position=3289; Antisense; GATCGTCGTCGCACAGTAAAAAGCA
>probe:Drosophila_2:1630638_at:314:501; Interrogation_Position=3293; Antisense; GTCGTCGCACAGTAAAAAGCACAAG
>probe:Drosophila_2:1630638_at:110:179; Interrogation_Position=3306; Antisense; AAAAAGCACAAGTCGAACTCCTCCT
>probe:Drosophila_2:1630638_at:599:209; Interrogation_Position=3309; Antisense; AAGCACAAGTCGAACTCCTCCTCGT
>probe:Drosophila_2:1630638_at:446:637; Interrogation_Position=3330; Antisense; TCGTCCTCTTCGCATTTAAAGTCCT
>probe:Drosophila_2:1630638_at:10:645; Interrogation_Position=3336; Antisense; TCTTCGCATTTAAAGTCCTCCAGCT
>probe:Drosophila_2:1630638_at:419:345; Interrogation_Position=3341; Antisense; GCATTTAAAGTCCTCCAGCTCCAAA
>probe:Drosophila_2:1630638_at:623:661; Interrogation_Position=3346; Antisense; TAAAGTCCTCCAGCTCCAAACATGG
>probe:Drosophila_2:1630638_at:258:117; Interrogation_Position=3357; Antisense; AGCTCCAAACATGGCAGCTCATCTA
>probe:Drosophila_2:1630638_at:311:179; Interrogation_Position=3363; Antisense; AAACATGGCAGCTCATCTAGCCCGT
>probe:Drosophila_2:1630638_at:698:567; Interrogation_Position=3369; Antisense; GGCAGCTCATCTAGCCCGTCGAAGT

Paste this into a BLAST search page for me
GAGTTCAAAGCACAGTCGCCGCGACGAGGAGGCTCGATCGTCGTCGCACAGCTCGATCGTCGTCGCACAGTAAAAGATCGTCGTCGCACAGTAAAAAGCAGTCGTCGCACAGTAAAAAGCACAAGAAAAAGCACAAGTCGAACTCCTCCTAAGCACAAGTCGAACTCCTCCTCGTTCGTCCTCTTCGCATTTAAAGTCCTTCTTCGCATTTAAAGTCCTCCAGCTGCATTTAAAGTCCTCCAGCTCCAAATAAAGTCCTCCAGCTCCAAACATGGAGCTCCAAACATGGCAGCTCATCTAAAACATGGCAGCTCATCTAGCCCGTGGCAGCTCATCTAGCCCGTCGAAGT

Full Affymetrix probeset data:

Annotations for 1630638_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime