Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630639_at:

>probe:Drosophila_2:1630639_at:65:337; Interrogation_Position=5012; Antisense; GCTCTTGATATGAGAACGCGCCCAA
>probe:Drosophila_2:1630639_at:443:423; Interrogation_Position=5075; Antisense; GAGAGATCCAACATTTACCAACAAA
>probe:Drosophila_2:1630639_at:726:235; Interrogation_Position=5121; Antisense; AATCGTAAGGTTTCCTCTTGGCAGC
>probe:Drosophila_2:1630639_at:221:479; Interrogation_Position=5130; Antisense; GTTTCCTCTTGGCAGCAGCAAACAA
>probe:Drosophila_2:1630639_at:511:397; Interrogation_Position=5210; Antisense; GACAAGTCTCACCAACTAACTAGAT
>probe:Drosophila_2:1630639_at:615:191; Interrogation_Position=5227; Antisense; AACTAGATGCACTCTCTGATATACA
>probe:Drosophila_2:1630639_at:318:393; Interrogation_Position=5258; Antisense; GAAATGGAACAACCTCTAGAATCAA
>probe:Drosophila_2:1630639_at:416:641; Interrogation_Position=5272; Antisense; TCTAGAATCAAAAGGCACTCGTCGC
>probe:Drosophila_2:1630639_at:382:567; Interrogation_Position=5285; Antisense; GGCACTCGTCGCAAACTTTAACTAA
>probe:Drosophila_2:1630639_at:88:709; Interrogation_Position=5302; Antisense; TTAACTAACACCTAGAGATCTCTTA
>probe:Drosophila_2:1630639_at:440:427; Interrogation_Position=5316; Antisense; GAGATCTCTTAAGAAACACACCTTT
>probe:Drosophila_2:1630639_at:557:707; Interrogation_Position=5340; Antisense; TTAAAGTACACAATCTCCAGTCGAG
>probe:Drosophila_2:1630639_at:22:501; Interrogation_Position=5359; Antisense; GTCGAGATGTTGACGATCCGATCGC
>probe:Drosophila_2:1630639_at:461:137; Interrogation_Position=5371; Antisense; ACGATCCGATCGCTTTGGGTTAGTA

Paste this into a BLAST search page for me
GCTCTTGATATGAGAACGCGCCCAAGAGAGATCCAACATTTACCAACAAAAATCGTAAGGTTTCCTCTTGGCAGCGTTTCCTCTTGGCAGCAGCAAACAAGACAAGTCTCACCAACTAACTAGATAACTAGATGCACTCTCTGATATACAGAAATGGAACAACCTCTAGAATCAATCTAGAATCAAAAGGCACTCGTCGCGGCACTCGTCGCAAACTTTAACTAATTAACTAACACCTAGAGATCTCTTAGAGATCTCTTAAGAAACACACCTTTTTAAAGTACACAATCTCCAGTCGAGGTCGAGATGTTGACGATCCGATCGCACGATCCGATCGCTTTGGGTTAGTA

Full Affymetrix probeset data:

Annotations for 1630639_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime