FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630640_at:

>probe:Drosophila_2:1630640_at:73:581; Interrogation_Position=439; Antisense; TGGCCACTGCCTGTGAGTATCGAGT
>probe:Drosophila_2:1630640_at:437:91; Interrogation_Position=454; Antisense; AGTATCGAGTGATGCGGCCCAACTT
>probe:Drosophila_2:1630640_at:186:565; Interrogation_Position=507; Antisense; GGAATCATTGCACCCAAGTGGCTAA
>probe:Drosophila_2:1630640_at:529:221; Interrogation_Position=522; Antisense; AAGTGGCTAATGTCCGGCTTCGCTA
>probe:Drosophila_2:1630640_at:545:717; Interrogation_Position=540; Antisense; TTCGCTAGCATACTGCCCAAACGGG
>probe:Drosophila_2:1630640_at:337:255; Interrogation_Position=557; Antisense; CAAACGGGTGGCAGAGCGAGCTCTC
>probe:Drosophila_2:1630640_at:386:419; Interrogation_Position=574; Antisense; GAGCTCTCACCCAAGGACGTATGTT
>probe:Drosophila_2:1630640_at:405:681; Interrogation_Position=593; Antisense; TATGTTCACCACACAGGAGGCCTTT
>probe:Drosophila_2:1630640_at:109:579; Interrogation_Position=624; Antisense; GGCCTGATCGATGAGATCGCCAGCA
>probe:Drosophila_2:1630640_at:56:553; Interrogation_Position=665; Antisense; GGAGAAGTGCGCTGCCTTCATCGGC
>probe:Drosophila_2:1630640_at:613:655; Interrogation_Position=698; Antisense; TAAGGTCAATCCTTTGGCCCGCGGA
>probe:Drosophila_2:1630640_at:301:283; Interrogation_Position=732; Antisense; CTCCAGTTCCGTGGCGACAACATTA
>probe:Drosophila_2:1630640_at:688:621; Interrogation_Position=788; Antisense; TGCTGACTTTGTAGCTCTAGCTTCT
>probe:Drosophila_2:1630640_at:450:569; Interrogation_Position=930; Antisense; TGGAACTATTCGTCCAAAGTCCCTT

Paste this into a BLAST search page for me
TGGCCACTGCCTGTGAGTATCGAGTAGTATCGAGTGATGCGGCCCAACTTGGAATCATTGCACCCAAGTGGCTAAAAGTGGCTAATGTCCGGCTTCGCTATTCGCTAGCATACTGCCCAAACGGGCAAACGGGTGGCAGAGCGAGCTCTCGAGCTCTCACCCAAGGACGTATGTTTATGTTCACCACACAGGAGGCCTTTGGCCTGATCGATGAGATCGCCAGCAGGAGAAGTGCGCTGCCTTCATCGGCTAAGGTCAATCCTTTGGCCCGCGGACTCCAGTTCCGTGGCGACAACATTATGCTGACTTTGTAGCTCTAGCTTCTTGGAACTATTCGTCCAAAGTCCCTT

Full Affymetrix probeset data:

Annotations for 1630640_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720