FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630641_at:

>probe:Drosophila_2:1630641_at:687:709; Interrogation_Position=1051; Antisense; TTAACGTTCATGATGCGTGCCAATA
>probe:Drosophila_2:1630641_at:279:133; Interrogation_Position=539; Antisense; ACCCATTTTTGTGTGTGACTGTACG
>probe:Drosophila_2:1630641_at:304:407; Interrogation_Position=555; Antisense; GACTGTACGCACGATAAGCTGGGAA
>probe:Drosophila_2:1630641_at:433:491; Interrogation_Position=597; Antisense; GTAACATTTCACACATTCCGCAATA
>probe:Drosophila_2:1630641_at:287:439; Interrogation_Position=627; Antisense; GAGGCCATTGCCATAAGTCAGTGCG
>probe:Drosophila_2:1630641_at:330:219; Interrogation_Position=641; Antisense; AAGTCAGTGCGAATCGTTGGCCTTC
>probe:Drosophila_2:1630641_at:619:343; Interrogation_Position=666; Antisense; GCATCCGTCTCCATTTGGAACGAAA
>probe:Drosophila_2:1630641_at:700:291; Interrogation_Position=691; Antisense; CGCTAACTGGATGCTACGATCTCGT
>probe:Drosophila_2:1630641_at:179:663; Interrogation_Position=745; Antisense; TAAACTGCGCCAACGTTGACTTGTC
>probe:Drosophila_2:1630641_at:429:401; Interrogation_Position=762; Antisense; GACTTGTCGCCAATTTTAAAGCCAC
>probe:Drosophila_2:1630641_at:552:711; Interrogation_Position=826; Antisense; TTCACTTCGAAACCCTACGTATCTA
>probe:Drosophila_2:1630641_at:624:273; Interrogation_Position=866; Antisense; CATTGTATTTCCCATTGGCGGACAA
>probe:Drosophila_2:1630641_at:105:21; Interrogation_Position=891; Antisense; ATATTGCCAGACATCGAGGATCACA
>probe:Drosophila_2:1630641_at:148:353; Interrogation_Position=923; Antisense; GCACGCAGCTATCTTCTTTTTGGAA

Paste this into a BLAST search page for me
TTAACGTTCATGATGCGTGCCAATAACCCATTTTTGTGTGTGACTGTACGGACTGTACGCACGATAAGCTGGGAAGTAACATTTCACACATTCCGCAATAGAGGCCATTGCCATAAGTCAGTGCGAAGTCAGTGCGAATCGTTGGCCTTCGCATCCGTCTCCATTTGGAACGAAACGCTAACTGGATGCTACGATCTCGTTAAACTGCGCCAACGTTGACTTGTCGACTTGTCGCCAATTTTAAAGCCACTTCACTTCGAAACCCTACGTATCTACATTGTATTTCCCATTGGCGGACAAATATTGCCAGACATCGAGGATCACAGCACGCAGCTATCTTCTTTTTGGAA

Full Affymetrix probeset data:

Annotations for 1630641_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720