Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630642_at:

>probe:Drosophila_2:1630642_at:472:561; Interrogation_Position=1477; Antisense; GGCAAAAGCTAAACCAAATTCCCAT
>probe:Drosophila_2:1630642_at:313:283; Interrogation_Position=1565; Antisense; CTGTGTTTAAATATACGCAATGGCC
>probe:Drosophila_2:1630642_at:501:391; Interrogation_Position=1600; Antisense; GAAATCCAGAAATCCGAACTGTTCG
>probe:Drosophila_2:1630642_at:535:383; Interrogation_Position=1615; Antisense; GAACTGTTCGTTCGGATAAGCGAGC
>probe:Drosophila_2:1630642_at:77:325; Interrogation_Position=1634; Antisense; GCGAGCAAACTAAAGGCATACTATG
>probe:Drosophila_2:1630642_at:718:553; Interrogation_Position=1722; Antisense; GGACCAAGTGATTACTTTACAGAAA
>probe:Drosophila_2:1630642_at:671:709; Interrogation_Position=1770; Antisense; TTAAGCTGAGTTTAAGATGCCAGTG
>probe:Drosophila_2:1630642_at:439:365; Interrogation_Position=1889; Antisense; GAATCTGTCGAACTCAAAATCACTG
>probe:Drosophila_2:1630642_at:487:185; Interrogation_Position=1904; Antisense; AAAATCACTGTAACGCTTTCATAGA
>probe:Drosophila_2:1630642_at:314:661; Interrogation_Position=1941; Antisense; TAACTGTCATTTTCGGTCCTCTTTA
>probe:Drosophila_2:1630642_at:91:679; Interrogation_Position=1979; Antisense; TAGATTCCCATGTTCCAATCAGAAG
>probe:Drosophila_2:1630642_at:623:397; Interrogation_Position=2008; Antisense; GACAAGCAACATTCGAGTGTACTTA
>probe:Drosophila_2:1630642_at:293:725; Interrogation_Position=2038; Antisense; TTGTCGATTAAGTTGACCTCCTAGC
>probe:Drosophila_2:1630642_at:523:215; Interrogation_Position=2047; Antisense; AAGTTGACCTCCTAGCTACTTATTT

Paste this into a BLAST search page for me
GGCAAAAGCTAAACCAAATTCCCATCTGTGTTTAAATATACGCAATGGCCGAAATCCAGAAATCCGAACTGTTCGGAACTGTTCGTTCGGATAAGCGAGCGCGAGCAAACTAAAGGCATACTATGGGACCAAGTGATTACTTTACAGAAATTAAGCTGAGTTTAAGATGCCAGTGGAATCTGTCGAACTCAAAATCACTGAAAATCACTGTAACGCTTTCATAGATAACTGTCATTTTCGGTCCTCTTTATAGATTCCCATGTTCCAATCAGAAGGACAAGCAACATTCGAGTGTACTTATTGTCGATTAAGTTGACCTCCTAGCAAGTTGACCTCCTAGCTACTTATTT

Full Affymetrix probeset data:

Annotations for 1630642_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime