FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630643_at:

>probe:Drosophila_2:1630643_at:148:189; Interrogation_Position=1345; Antisense; AACAGCGTGGTTCGCAATCTGACCG
>probe:Drosophila_2:1630643_at:347:573; Interrogation_Position=1380; Antisense; GGCTGCTACCAGTGAGGATGGCTTT
>probe:Drosophila_2:1630643_at:381:625; Interrogation_Position=1410; Antisense; TGCGCCCCTGCTGAAACTATTGGAG
>probe:Drosophila_2:1630643_at:546:237; Interrogation_Position=1459; Antisense; AATCTGATCGAAAAGGTGCGCGCCA
>probe:Drosophila_2:1630643_at:685:505; Interrogation_Position=1474; Antisense; GTGCGCGCCATTTACGGCTTTAAGG
>probe:Drosophila_2:1630643_at:571:473; Interrogation_Position=1507; Antisense; GGACCCAATGGACAGACCGGTTTCT
>probe:Drosophila_2:1630643_at:8:511; Interrogation_Position=1589; Antisense; GTGACGTTACCTTTATCATTAGCGA
>probe:Drosophila_2:1630643_at:76:409; Interrogation_Position=1612; Antisense; GACGATGATGTCTTTGAGCTGCTAA
>probe:Drosophila_2:1630643_at:40:173; Interrogation_Position=1641; Antisense; AAAGCTGCCACCACAGAAGGCCTTT
>probe:Drosophila_2:1630643_at:346:371; Interrogation_Position=1656; Antisense; GAAGGCCTTTTTCCAGGGCAAGATC
>probe:Drosophila_2:1630643_at:633:177; Interrogation_Position=1711; Antisense; AAACTGATGGACCTGCAGCGATCCG
>probe:Drosophila_2:1630643_at:533:685; Interrogation_Position=1769; Antisense; TATAGGCTCCTCTTCTTGTGCAATG
>probe:Drosophila_2:1630643_at:629:617; Interrogation_Position=1792; Antisense; TGCAGCATCTTGGTGGCTTTGGATC
>probe:Drosophila_2:1630643_at:439:629; Interrogation_Position=1842; Antisense; TCCAGCATACGCTTTTTATACGACT

Paste this into a BLAST search page for me
AACAGCGTGGTTCGCAATCTGACCGGGCTGCTACCAGTGAGGATGGCTTTTGCGCCCCTGCTGAAACTATTGGAGAATCTGATCGAAAAGGTGCGCGCCAGTGCGCGCCATTTACGGCTTTAAGGGGACCCAATGGACAGACCGGTTTCTGTGACGTTACCTTTATCATTAGCGAGACGATGATGTCTTTGAGCTGCTAAAAAGCTGCCACCACAGAAGGCCTTTGAAGGCCTTTTTCCAGGGCAAGATCAAACTGATGGACCTGCAGCGATCCGTATAGGCTCCTCTTCTTGTGCAATGTGCAGCATCTTGGTGGCTTTGGATCTCCAGCATACGCTTTTTATACGACT

Full Affymetrix probeset data:

Annotations for 1630643_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720