FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630645_at:

>probe:Drosophila_2:1630645_at:707:233; Interrogation_Position=202; Antisense; AATGCCTGCGGTAAGAATTGCCTGG
>probe:Drosophila_2:1630645_at:617:363; Interrogation_Position=216; Antisense; GAATTGCCTGGGTAATCTGCTCACC
>probe:Drosophila_2:1630645_at:448:557; Interrogation_Position=295; Antisense; GGACTACGAGGACTCCAACTTTTTG
>probe:Drosophila_2:1630645_at:308:57; Interrogation_Position=341; Antisense; ATGAGGTGCTCCAACAGTTTGCCAA
>probe:Drosophila_2:1630645_at:78:497; Interrogation_Position=406; Antisense; GTCTACCTGGTGATGCGTTCGAAGA
>probe:Drosophila_2:1630645_at:237:223; Interrogation_Position=430; Antisense; AAGGGTCTAGAGATCTCCAGCTTTC
>probe:Drosophila_2:1630645_at:236:161; Interrogation_Position=499; Antisense; ACAAGCTGCGTAGACTGGCGGGCCA
>probe:Drosophila_2:1630645_at:620:607; Interrogation_Position=545; Antisense; TGAGGCCATCGAATCTGCATCTCAG
>probe:Drosophila_2:1630645_at:305:129; Interrogation_Position=584; Antisense; ACCAGAATCGTGTGTCCTTCAACAA
>probe:Drosophila_2:1630645_at:630:153; Interrogation_Position=608; Antisense; ACAGCGACAATTTCCGGGTGTTGAA
>probe:Drosophila_2:1630645_at:283:463; Interrogation_Position=625; Antisense; GTGTTGAACAAGAGGCCCCACAGTC
>probe:Drosophila_2:1630645_at:688:163; Interrogation_Position=677; Antisense; AAATATTCTGTGTGAACGCCTCCTG
>probe:Drosophila_2:1630645_at:24:181; Interrogation_Position=733; Antisense; AAAACGTATTTCTCGCCCATTTATG
>probe:Drosophila_2:1630645_at:254:11; Interrogation_Position=768; Antisense; ATTCTTCGACCACATAATCAGGCGC

Paste this into a BLAST search page for me
AATGCCTGCGGTAAGAATTGCCTGGGAATTGCCTGGGTAATCTGCTCACCGGACTACGAGGACTCCAACTTTTTGATGAGGTGCTCCAACAGTTTGCCAAGTCTACCTGGTGATGCGTTCGAAGAAAGGGTCTAGAGATCTCCAGCTTTCACAAGCTGCGTAGACTGGCGGGCCATGAGGCCATCGAATCTGCATCTCAGACCAGAATCGTGTGTCCTTCAACAAACAGCGACAATTTCCGGGTGTTGAAGTGTTGAACAAGAGGCCCCACAGTCAAATATTCTGTGTGAACGCCTCCTGAAAACGTATTTCTCGCCCATTTATGATTCTTCGACCACATAATCAGGCGC

Full Affymetrix probeset data:

Annotations for 1630645_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720