FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630646_at:

>probe:Drosophila_2:1630646_at:480:555; Interrogation_Position=385; Antisense; GGACCTCAACTAGTGTGTCGCTATA
>probe:Drosophila_2:1630646_at:186:129; Interrogation_Position=415; Antisense; ACCACCACTCCATTTATGCGAATAG
>probe:Drosophila_2:1630646_at:211:77; Interrogation_Position=455; Antisense; AGGAGATCAGCAGAGACCCACTTAT
>probe:Drosophila_2:1630646_at:189:149; Interrogation_Position=474; Antisense; ACTTATCTGGTTATATCACGACGTG
>probe:Drosophila_2:1630646_at:376:117; Interrogation_Position=516; Antisense; AGCTCAGTTGACGAATGTGACCCGA
>probe:Drosophila_2:1630646_at:193:77; Interrogation_Position=542; Antisense; AGGAGATGATTCTGGGCACCACCAC
>probe:Drosophila_2:1630646_at:42:191; Interrogation_Position=568; Antisense; AACTATACGACTCCAGATCGGGTGA
>probe:Drosophila_2:1630646_at:148:451; Interrogation_Position=583; Antisense; GATCGGGTGAATCGTCTCTTTCACA
>probe:Drosophila_2:1630646_at:233:151; Interrogation_Position=668; Antisense; ACATATCTGGCCTGGATGTGGGCAA
>probe:Drosophila_2:1630646_at:710:339; Interrogation_Position=768; Antisense; GCTTTATCCGGCAAGTAACCTGATT
>probe:Drosophila_2:1630646_at:449:681; Interrogation_Position=801; Antisense; TATGACCGATGTTCCAGTGGGTGGC
>probe:Drosophila_2:1630646_at:10:277; Interrogation_Position=880; Antisense; CTCTTTTGGTACAACCTCCACAATA
>probe:Drosophila_2:1630646_at:659:591; Interrogation_Position=906; Antisense; TGGTGACCCAAATCTGCTGACCAGG
>probe:Drosophila_2:1630646_at:471:503; Interrogation_Position=941; Antisense; GTCCCACAATTGTAGGCAGCCGATG

Paste this into a BLAST search page for me
GGACCTCAACTAGTGTGTCGCTATAACCACCACTCCATTTATGCGAATAGAGGAGATCAGCAGAGACCCACTTATACTTATCTGGTTATATCACGACGTGAGCTCAGTTGACGAATGTGACCCGAAGGAGATGATTCTGGGCACCACCACAACTATACGACTCCAGATCGGGTGAGATCGGGTGAATCGTCTCTTTCACAACATATCTGGCCTGGATGTGGGCAAGCTTTATCCGGCAAGTAACCTGATTTATGACCGATGTTCCAGTGGGTGGCCTCTTTTGGTACAACCTCCACAATATGGTGACCCAAATCTGCTGACCAGGGTCCCACAATTGTAGGCAGCCGATG

Full Affymetrix probeset data:

Annotations for 1630646_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720