FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630649_at:

>probe:Drosophila_2:1630649_at:716:609; Interrogation_Position=116; Antisense; TGAGCCACATAGTGCCGCATTGCAA
>probe:Drosophila_2:1630649_at:213:81; Interrogation_Position=149; Antisense; AGGTGCTCAAGTTTGGCATGCCCGC
>probe:Drosophila_2:1630649_at:482:347; Interrogation_Position=164; Antisense; GCATGCCCGCGAATTCTTCAGAATA
>probe:Drosophila_2:1630649_at:144:385; Interrogation_Position=220; Antisense; GAACTATCCTACTTTGGCATTCGCA
>probe:Drosophila_2:1630649_at:587:255; Interrogation_Position=23; Antisense; CAAAAATTTCACTCGCAGCTCTGGT
>probe:Drosophila_2:1630649_at:674:155; Interrogation_Position=298; Antisense; ACACATCTGTCCATCGACGGAGGGA
>probe:Drosophila_2:1630649_at:76:75; Interrogation_Position=335; Antisense; AGGAGACCTGCCAGTTGGTTCGCAT
>probe:Drosophila_2:1630649_at:296:417; Interrogation_Position=363; Antisense; GAGCTTACGGCATTTCAAGGGCTTC
>probe:Drosophila_2:1630649_at:95:223; Interrogation_Position=379; Antisense; AAGGGCTTCTACTCAACGACTGACT
>probe:Drosophila_2:1630649_at:695:425; Interrogation_Position=409; Antisense; GAGATGCTGGGTTGTCTGGCCAATC
>probe:Drosophila_2:1630649_at:720:75; Interrogation_Position=437; Antisense; AGGAGCTATGCGTCTCGATATTCTG
>probe:Drosophila_2:1630649_at:446:689; Interrogation_Position=455; Antisense; TATTCTGCCCAACGGATATTTCCAA
>probe:Drosophila_2:1630649_at:542:639; Interrogation_Position=586; Antisense; TCTGAACCAGTTGCCTTAGTCTTAA
>probe:Drosophila_2:1630649_at:323:37; Interrogation_Position=71; Antisense; ATCTTCGCAGTCTTCATTTGGGCTA

Paste this into a BLAST search page for me
TGAGCCACATAGTGCCGCATTGCAAAGGTGCTCAAGTTTGGCATGCCCGCGCATGCCCGCGAATTCTTCAGAATAGAACTATCCTACTTTGGCATTCGCACAAAAATTTCACTCGCAGCTCTGGTACACATCTGTCCATCGACGGAGGGAAGGAGACCTGCCAGTTGGTTCGCATGAGCTTACGGCATTTCAAGGGCTTCAAGGGCTTCTACTCAACGACTGACTGAGATGCTGGGTTGTCTGGCCAATCAGGAGCTATGCGTCTCGATATTCTGTATTCTGCCCAACGGATATTTCCAATCTGAACCAGTTGCCTTAGTCTTAAATCTTCGCAGTCTTCATTTGGGCTA

Full Affymetrix probeset data:

Annotations for 1630649_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720