FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630650_at:

>probe:Drosophila_2:1630650_at:288:115; Interrogation_Position=3628; Antisense; AGCATCGTATTTTTCTATACACCAA
>probe:Drosophila_2:1630650_at:347:665; Interrogation_Position=3645; Antisense; TACACCAATGGCGTACTTGTCTTAA
>probe:Drosophila_2:1630650_at:296:213; Interrogation_Position=3669; Antisense; AAGACGCCTGATTGGTTTGATCTGA
>probe:Drosophila_2:1630650_at:509:451; Interrogation_Position=3687; Antisense; GATCTGAATTTTGTCGCGATGATTT
>probe:Drosophila_2:1630650_at:379:699; Interrogation_Position=3717; Antisense; TTTTTGTTAACAACGCTGTGCGCAA
>probe:Drosophila_2:1630650_at:382:265; Interrogation_Position=3815; Antisense; CATGCATTAATTGGCCAACCCGATA
>probe:Drosophila_2:1630650_at:608:709; Interrogation_Position=3853; Antisense; TTCCAAGGTCCAGTTTAAGCTAATT
>probe:Drosophila_2:1630650_at:325:251; Interrogation_Position=3903; Antisense; CAAGTCATCAGATTTTTGCTCGAAA
>probe:Drosophila_2:1630650_at:385:481; Interrogation_Position=3929; Antisense; GTATATTACCCGCATGGCTTGCAGC
>probe:Drosophila_2:1630650_at:141:571; Interrogation_Position=3944; Antisense; GGCTTGCAGCCATTGAACCTAAAGT
>probe:Drosophila_2:1630650_at:8:675; Interrogation_Position=3968; Antisense; TAGCACCAGGCTACGTCTCAAAGAC
>probe:Drosophila_2:1630650_at:353:17; Interrogation_Position=4013; Antisense; ATTTTTGTATTTATTGAGCGGCATT
>probe:Drosophila_2:1630650_at:20:419; Interrogation_Position=4028; Antisense; GAGCGGCATTTGGTCGCCATGAAAT
>probe:Drosophila_2:1630650_at:527:279; Interrogation_Position=4097; Antisense; CTAAGTTTTTGCGTCTTATTTAGCA

Paste this into a BLAST search page for me
AGCATCGTATTTTTCTATACACCAATACACCAATGGCGTACTTGTCTTAAAAGACGCCTGATTGGTTTGATCTGAGATCTGAATTTTGTCGCGATGATTTTTTTTGTTAACAACGCTGTGCGCAACATGCATTAATTGGCCAACCCGATATTCCAAGGTCCAGTTTAAGCTAATTCAAGTCATCAGATTTTTGCTCGAAAGTATATTACCCGCATGGCTTGCAGCGGCTTGCAGCCATTGAACCTAAAGTTAGCACCAGGCTACGTCTCAAAGACATTTTTGTATTTATTGAGCGGCATTGAGCGGCATTTGGTCGCCATGAAATCTAAGTTTTTGCGTCTTATTTAGCA

Full Affymetrix probeset data:

Annotations for 1630650_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720