FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630655_at:

>probe:Drosophila_2:1630655_at:390:419; Interrogation_Position=188; Antisense; GAGCAGTCCTAAGTGCAGCACATTG
>probe:Drosophila_2:1630655_at:9:5; Interrogation_Position=209; Antisense; ATTGTGTTTATGGATCGCAGCCGGA
>probe:Drosophila_2:1630655_at:59:353; Interrogation_Position=225; Antisense; GCAGCCGGAGGGATTCACGGTTCAC
>probe:Drosophila_2:1630655_at:403:303; Interrogation_Position=251; Antisense; CCGGCGCGAGTCGTTTGGACCAAGA
>probe:Drosophila_2:1630655_at:404:69; Interrogation_Position=275; Antisense; AGGCTCCAGTGGTTCGCAATGTAGT
>probe:Drosophila_2:1630655_at:520:601; Interrogation_Position=294; Antisense; TGTAGTTATGTTTCACACTTCGCCC
>probe:Drosophila_2:1630655_at:343:311; Interrogation_Position=328; Antisense; GCCACTAACTTCGACATGGACGTAG
>probe:Drosophila_2:1630655_at:3:409; Interrogation_Position=346; Antisense; GACGTAGCTTTGTTGCAGTTGCAGG
>probe:Drosophila_2:1630655_at:222:663; Interrogation_Position=393; Antisense; TAAAGTCGCCACCATTAGTCCTTGT
>probe:Drosophila_2:1630655_at:151:365; Interrogation_Position=477; Antisense; GAATAACCGTGAACCTGCCGAACAG
>probe:Drosophila_2:1630655_at:319:721; Interrogation_Position=571; Antisense; TTGAGCGATTCCATGCTATGTGCCG
>probe:Drosophila_2:1630655_at:172:435; Interrogation_Position=635; Antisense; GAGGTCCTTTGGTCTACCGCGGTCA
>probe:Drosophila_2:1630655_at:111:331; Interrogation_Position=653; Antisense; GCGGTCAGGTTTGTGGCATTGTCTC
>probe:Drosophila_2:1630655_at:96:177; Interrogation_Position=761; Antisense; AAACCCTACGCAGGATTGGATCCTA

Paste this into a BLAST search page for me
GAGCAGTCCTAAGTGCAGCACATTGATTGTGTTTATGGATCGCAGCCGGAGCAGCCGGAGGGATTCACGGTTCACCCGGCGCGAGTCGTTTGGACCAAGAAGGCTCCAGTGGTTCGCAATGTAGTTGTAGTTATGTTTCACACTTCGCCCGCCACTAACTTCGACATGGACGTAGGACGTAGCTTTGTTGCAGTTGCAGGTAAAGTCGCCACCATTAGTCCTTGTGAATAACCGTGAACCTGCCGAACAGTTGAGCGATTCCATGCTATGTGCCGGAGGTCCTTTGGTCTACCGCGGTCAGCGGTCAGGTTTGTGGCATTGTCTCAAACCCTACGCAGGATTGGATCCTA

Full Affymetrix probeset data:

Annotations for 1630655_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720