FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630657_at:

>probe:Drosophila_2:1630657_at:218:271; Interrogation_Position=3478; Antisense; CATGCGACGTCATACCGGTGAGAAA
>probe:Drosophila_2:1630657_at:209:423; Interrogation_Position=3497; Antisense; GAGAAACCTTTCAAGTGCGAGTACT
>probe:Drosophila_2:1630657_at:97:623; Interrogation_Position=3512; Antisense; TGCGAGTACTGCACTATGGCCTTCC
>probe:Drosophila_2:1630657_at:461:325; Interrogation_Position=3579; Antisense; GCGAACGTCCACATGTATGCACAGT
>probe:Drosophila_2:1630657_at:469:153; Interrogation_Position=3599; Antisense; ACAGTGTGCCAGAAGGGATTCGCCC
>probe:Drosophila_2:1630657_at:220:11; Interrogation_Position=3616; Antisense; ATTCGCCCGTTCGTATAAACTGCAG
>probe:Drosophila_2:1630657_at:639:361; Interrogation_Position=3651; Antisense; GAATTCACAGCGGAGAACGGCCCTA
>probe:Drosophila_2:1630657_at:725:631; Interrogation_Position=3754; Antisense; TCCCTACCAATGTGGCGTCTGTGGA
>probe:Drosophila_2:1630657_at:202:425; Interrogation_Position=3777; Antisense; GAGAGCGCTTTATCCAGGGCACTGC
>probe:Drosophila_2:1630657_at:84:635; Interrogation_Position=3814; Antisense; TCGCATGCAGCAGAGCCACTATGAG
>probe:Drosophila_2:1630657_at:175:399; Interrogation_Position=3843; Antisense; GACAGGAATCAGTTGAGCCCACCAG
>probe:Drosophila_2:1630657_at:587:575; Interrogation_Position=3867; Antisense; GGCGCACGGTTCTAGAGCAGTTTAC
>probe:Drosophila_2:1630657_at:372:89; Interrogation_Position=3912; Antisense; AGTACTACCTATTCTGTTCAGTTCA
>probe:Drosophila_2:1630657_at:557:713; Interrogation_Position=3928; Antisense; TTCAGTTCAGTTTTCGTCAGCGGTA

Paste this into a BLAST search page for me
CATGCGACGTCATACCGGTGAGAAAGAGAAACCTTTCAAGTGCGAGTACTTGCGAGTACTGCACTATGGCCTTCCGCGAACGTCCACATGTATGCACAGTACAGTGTGCCAGAAGGGATTCGCCCATTCGCCCGTTCGTATAAACTGCAGGAATTCACAGCGGAGAACGGCCCTATCCCTACCAATGTGGCGTCTGTGGAGAGAGCGCTTTATCCAGGGCACTGCTCGCATGCAGCAGAGCCACTATGAGGACAGGAATCAGTTGAGCCCACCAGGGCGCACGGTTCTAGAGCAGTTTACAGTACTACCTATTCTGTTCAGTTCATTCAGTTCAGTTTTCGTCAGCGGTA

Full Affymetrix probeset data:

Annotations for 1630657_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720