FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630658_at:

>probe:Drosophila_2:1630658_at:198:481; Interrogation_Position=3881; Antisense; GTTTGGCTGTGCGTAAGGAGATTTC
>probe:Drosophila_2:1630658_at:541:17; Interrogation_Position=3901; Antisense; ATTTCGAGGACTTTCCCTGAGGGCT
>probe:Drosophila_2:1630658_at:459:605; Interrogation_Position=3918; Antisense; TGAGGGCTCCCACTGGCAGTTTCTG
>probe:Drosophila_2:1630658_at:37:93; Interrogation_Position=3935; Antisense; AGTTTCTGCCCAATGCCGCCAATGT
>probe:Drosophila_2:1630658_at:706:543; Interrogation_Position=3972; Antisense; GGATCAGCATTGTGGCTTCCGCTCG
>probe:Drosophila_2:1630658_at:465:523; Interrogation_Position=4019; Antisense; GGGCCATCTCCCTCAATGGTATCAT
>probe:Drosophila_2:1630658_at:518:229; Interrogation_Position=4033; Antisense; AATGGTATCATTTGCAGGCGCTGCG
>probe:Drosophila_2:1630658_at:154:631; Interrogation_Position=4074; Antisense; TCCTGCAGGCGTAGGATGGAACCTT
>probe:Drosophila_2:1630658_at:71:585; Interrogation_Position=4090; Antisense; TGGAACCTTGGCATTGCGGGCCAAT
>probe:Drosophila_2:1630658_at:45:583; Interrogation_Position=4114; Antisense; TGGCAAAATGTCTCTGTCGAAGGAT
>probe:Drosophila_2:1630658_at:487:497; Interrogation_Position=4167; Antisense; GTGCATTCCTATTTACTTACGGACG
>probe:Drosophila_2:1630658_at:504:141; Interrogation_Position=4185; Antisense; ACGGACGATCCTGTTTGTTGTATTT
>probe:Drosophila_2:1630658_at:387:23; Interrogation_Position=4228; Antisense; ATATGTGACCATGCCAACGCTTTTT
>probe:Drosophila_2:1630658_at:331:353; Interrogation_Position=4405; Antisense; GCAGCCGTGATTGTATTTCCTTTTT

Paste this into a BLAST search page for me
GTTTGGCTGTGCGTAAGGAGATTTCATTTCGAGGACTTTCCCTGAGGGCTTGAGGGCTCCCACTGGCAGTTTCTGAGTTTCTGCCCAATGCCGCCAATGTGGATCAGCATTGTGGCTTCCGCTCGGGGCCATCTCCCTCAATGGTATCATAATGGTATCATTTGCAGGCGCTGCGTCCTGCAGGCGTAGGATGGAACCTTTGGAACCTTGGCATTGCGGGCCAATTGGCAAAATGTCTCTGTCGAAGGATGTGCATTCCTATTTACTTACGGACGACGGACGATCCTGTTTGTTGTATTTATATGTGACCATGCCAACGCTTTTTGCAGCCGTGATTGTATTTCCTTTTT

Full Affymetrix probeset data:

Annotations for 1630658_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720