Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630660_at:

>probe:Drosophila_2:1630660_at:650:105; Interrogation_Position=1004; Antisense; AGACTTGCAGCGTAAGAACACCGTG
>probe:Drosophila_2:1630660_at:242:259; Interrogation_Position=1034; Antisense; CACTTGCTCAACAACGACATCGTAT
>probe:Drosophila_2:1630660_at:562:53; Interrogation_Position=1082; Antisense; ATGAAGCGCGGTACCATTATGGTGT
>probe:Drosophila_2:1630660_at:387:303; Interrogation_Position=1115; Antisense; CCGCCATCGTTTACTTCAAAGGACT
>probe:Drosophila_2:1630660_at:450:651; Interrogation_Position=1130; Antisense; TCAAAGGACTTGGACACCCGTTTCT
>probe:Drosophila_2:1630660_at:236:35; Interrogation_Position=1174; Antisense; ATCACGCTGCACCAAATCGAAATCA
>probe:Drosophila_2:1630660_at:638:117; Interrogation_Position=1239; Antisense; AGCTGAACAGCAACTCGACTACTCT
>probe:Drosophila_2:1630660_at:65:125; Interrogation_Position=1296; Antisense; AGCGCCTCTAGTGCAATCTCTTCAA
>probe:Drosophila_2:1630660_at:293:239; Interrogation_Position=1310; Antisense; AATCTCTTCAAACAGACCGTCGGCT
>probe:Drosophila_2:1630660_at:151:87; Interrogation_Position=1353; Antisense; AGTTCAAGGGCCACCAGCTGAAGGC
>probe:Drosophila_2:1630660_at:97:119; Interrogation_Position=1368; Antisense; AGCTGAAGGCGCATCAATCTCTCTG
>probe:Drosophila_2:1630660_at:637:237; Interrogation_Position=1383; Antisense; AATCTCTCTGCCAGGGTCGCAAGAA
>probe:Drosophila_2:1630660_at:445:209; Interrogation_Position=1403; Antisense; AAGAAGCACTAGGACGGCACCTTAT
>probe:Drosophila_2:1630660_at:231:287; Interrogation_Position=1417; Antisense; CGGCACCTTATACGAACCATACATT

Paste this into a BLAST search page for me
AGACTTGCAGCGTAAGAACACCGTGCACTTGCTCAACAACGACATCGTATATGAAGCGCGGTACCATTATGGTGTCCGCCATCGTTTACTTCAAAGGACTTCAAAGGACTTGGACACCCGTTTCTATCACGCTGCACCAAATCGAAATCAAGCTGAACAGCAACTCGACTACTCTAGCGCCTCTAGTGCAATCTCTTCAAAATCTCTTCAAACAGACCGTCGGCTAGTTCAAGGGCCACCAGCTGAAGGCAGCTGAAGGCGCATCAATCTCTCTGAATCTCTCTGCCAGGGTCGCAAGAAAAGAAGCACTAGGACGGCACCTTATCGGCACCTTATACGAACCATACATT

Full Affymetrix probeset data:

Annotations for 1630660_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime