Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630663_a_at:

>probe:Drosophila_2:1630663_a_at:174:575; Interrogation_Position=163; Antisense; GGCGAGGGCTTTGAAATGCTGTACA
>probe:Drosophila_2:1630663_a_at:445:491; Interrogation_Position=183; Antisense; GTACAACCAAACGAGCAGTGGCCAT
>probe:Drosophila_2:1630663_a_at:445:539; Interrogation_Position=20; Antisense; GGTTTCGGACTGTAAACATCTCTAA
>probe:Drosophila_2:1630663_a_at:239:579; Interrogation_Position=202; Antisense; GGCCATGGATATAGCCAGCAGCAGA
>probe:Drosophila_2:1630663_a_at:218:493; Interrogation_Position=227; Antisense; GTAATTGCGGACAAGGTTCTTCAAA
>probe:Drosophila_2:1630663_a_at:270:245; Interrogation_Position=250; Antisense; AATTTTAATGGTGCATCTGCATCGC
>probe:Drosophila_2:1630663_a_at:306:619; Interrogation_Position=267; Antisense; TGCATCGCTTGGTGGTCCTGGCTAT
>probe:Drosophila_2:1630663_a_at:531:349; Interrogation_Position=293; Antisense; GCAGTCCCTTGCGATACACAAAAAT
>probe:Drosophila_2:1630663_a_at:583:443; Interrogation_Position=327; Antisense; GATGAACTCTCGCAACGGGCTTTAC
>probe:Drosophila_2:1630663_a_at:525:419; Interrogation_Position=372; Antisense; GAGCAGTGGGCAAGGCGACTACTAT
>probe:Drosophila_2:1630663_a_at:464:403; Interrogation_Position=388; Antisense; GACTACTATAATACATTGCCCGGCC
>probe:Drosophila_2:1630663_a_at:348:727; Interrogation_Position=413; Antisense; TTGGCGGCCCAGAAGGTCAAGCTTA
>probe:Drosophila_2:1630663_a_at:1:373; Interrogation_Position=424; Antisense; GAAGGTCAAGCTTATCAGTCGCGGG
>probe:Drosophila_2:1630663_a_at:570:491; Interrogation_Position=473; Antisense; GTAAACCCATGCACTTCGTAGAAAT

Paste this into a BLAST search page for me
GGCGAGGGCTTTGAAATGCTGTACAGTACAACCAAACGAGCAGTGGCCATGGTTTCGGACTGTAAACATCTCTAAGGCCATGGATATAGCCAGCAGCAGAGTAATTGCGGACAAGGTTCTTCAAAAATTTTAATGGTGCATCTGCATCGCTGCATCGCTTGGTGGTCCTGGCTATGCAGTCCCTTGCGATACACAAAAATGATGAACTCTCGCAACGGGCTTTACGAGCAGTGGGCAAGGCGACTACTATGACTACTATAATACATTGCCCGGCCTTGGCGGCCCAGAAGGTCAAGCTTAGAAGGTCAAGCTTATCAGTCGCGGGGTAAACCCATGCACTTCGTAGAAAT

Full Affymetrix probeset data:

Annotations for 1630663_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime