Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630665_at:

>probe:Drosophila_2:1630665_at:615:381; Interrogation_Position=1535; Antisense; GAACGATACGTGTGCGCAGTCTGCG
>probe:Drosophila_2:1630665_at:725:621; Interrogation_Position=1556; Antisense; TGCGGCAGACTGAGAGCGTAACGAT
>probe:Drosophila_2:1630665_at:583:69; Interrogation_Position=1568; Antisense; AGAGCGTAACGATGGGACCGACTTC
>probe:Drosophila_2:1630665_at:160:593; Interrogation_Position=1580; Antisense; TGGGACCGACTTCGTTCTCGATGAA
>probe:Drosophila_2:1630665_at:102:717; Interrogation_Position=1590; Antisense; TTCGTTCTCGATGAAGCAGCGGTTT
>probe:Drosophila_2:1630665_at:424:207; Interrogation_Position=1603; Antisense; AAGCAGCGGTTTATGGACGCCTCCA
>probe:Drosophila_2:1630665_at:306:477; Interrogation_Position=1611; Antisense; GTTTATGGACGCCTCCAACCAGATC
>probe:Drosophila_2:1630665_at:28:47; Interrogation_Position=1633; Antisense; ATCCGCAAGCTGGTGGTGATCCGCA
>probe:Drosophila_2:1630665_at:68:605; Interrogation_Position=1649; Antisense; TGATCCGCAACGCATTTGCCAATGG
>probe:Drosophila_2:1630665_at:10:219; Interrogation_Position=1669; Antisense; AATGGGTCCACCAGTGATTTACCGC
>probe:Drosophila_2:1630665_at:115:605; Interrogation_Position=1683; Antisense; TGATTTACCGCCATTGTCTATTCCA
>probe:Drosophila_2:1630665_at:510:335; Interrogation_Position=1709; Antisense; GCTGCCCACGCAATGGACGTCATAA
>probe:Drosophila_2:1630665_at:170:229; Interrogation_Position=1720; Antisense; AATGGACGTCATAACCACTCCACCA
>probe:Drosophila_2:1630665_at:555:709; Interrogation_Position=1746; Antisense; TTCACACAAACACAGATGCTCGAGT

Paste this into a BLAST search page for me
GAACGATACGTGTGCGCAGTCTGCGTGCGGCAGACTGAGAGCGTAACGATAGAGCGTAACGATGGGACCGACTTCTGGGACCGACTTCGTTCTCGATGAATTCGTTCTCGATGAAGCAGCGGTTTAAGCAGCGGTTTATGGACGCCTCCAGTTTATGGACGCCTCCAACCAGATCATCCGCAAGCTGGTGGTGATCCGCATGATCCGCAACGCATTTGCCAATGGAATGGGTCCACCAGTGATTTACCGCTGATTTACCGCCATTGTCTATTCCAGCTGCCCACGCAATGGACGTCATAAAATGGACGTCATAACCACTCCACCATTCACACAAACACAGATGCTCGAGT

Full Affymetrix probeset data:

Annotations for 1630665_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime