Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630668_a_at:

>probe:Drosophila_2:1630668_a_at:262:29; Interrogation_Position=1039; Antisense; ATACGCAGCCTTGTGAGGTCAACTA
>probe:Drosophila_2:1630668_a_at:112:613; Interrogation_Position=1079; Antisense; TGAAGCCACCAAATTTCCCCGAGTC
>probe:Drosophila_2:1630668_a_at:379:593; Interrogation_Position=531; Antisense; TGGGAGTTCGCCACGCTGGACAAGT
>probe:Drosophila_2:1630668_a_at:249:399; Interrogation_Position=572; Antisense; GACAGACATCTTTGTGTGGCGCGGT
>probe:Drosophila_2:1630668_a_at:700:679; Interrogation_Position=597; Antisense; TATCCGTACGGCGTCTTCTGGTATG
>probe:Drosophila_2:1630668_a_at:406:49; Interrogation_Position=619; Antisense; ATGCCTTCTGCTTTGTGGGCTTCCA
>probe:Drosophila_2:1630668_a_at:531:569; Interrogation_Position=636; Antisense; GGCTTCCAGGTGCACGGATTTACGC
>probe:Drosophila_2:1630668_a_at:234:461; Interrogation_Position=652; Antisense; GATTTACGCTGTACTTCGCCTACAA
>probe:Drosophila_2:1630668_a_at:13:665; Interrogation_Position=672; Antisense; TACAACCTGGTCAAGGCCTGGAAGG
>probe:Drosophila_2:1630668_a_at:694:563; Interrogation_Position=691; Antisense; GGAAGGCCAGAACTGCCACGCGCAA
>probe:Drosophila_2:1630668_a_at:675:309; Interrogation_Position=706; Antisense; CCACGCGCAAGTTCCAGTAATCTAA
>probe:Drosophila_2:1630668_a_at:75:633; Interrogation_Position=735; Antisense; TCGCCAAACTAGTAAACGCCGGAAT
>probe:Drosophila_2:1630668_a_at:451:353; Interrogation_Position=852; Antisense; GCAGCTGTTAAGGTATCGCACACTT
>probe:Drosophila_2:1630668_a_at:302:177; Interrogation_Position=906; Antisense; AAACTGAGCGAAGCGTCGGCGGTAA

Paste this into a BLAST search page for me
ATACGCAGCCTTGTGAGGTCAACTATGAAGCCACCAAATTTCCCCGAGTCTGGGAGTTCGCCACGCTGGACAAGTGACAGACATCTTTGTGTGGCGCGGTTATCCGTACGGCGTCTTCTGGTATGATGCCTTCTGCTTTGTGGGCTTCCAGGCTTCCAGGTGCACGGATTTACGCGATTTACGCTGTACTTCGCCTACAATACAACCTGGTCAAGGCCTGGAAGGGGAAGGCCAGAACTGCCACGCGCAACCACGCGCAAGTTCCAGTAATCTAATCGCCAAACTAGTAAACGCCGGAATGCAGCTGTTAAGGTATCGCACACTTAAACTGAGCGAAGCGTCGGCGGTAA

Full Affymetrix probeset data:

Annotations for 1630668_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime