FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630669_at:

>probe:Drosophila_2:1630669_at:671:231; Interrogation_Position=117; Antisense; AATGCTAACGCAAATGCCAACGCAA
>probe:Drosophila_2:1630669_at:207:521; Interrogation_Position=160; Antisense; GTGGAAGACCAGGATTCAGCGGACC
>probe:Drosophila_2:1630669_at:319:463; Interrogation_Position=172; Antisense; GATTCAGCGGACCTGGTTTCCAGAA
>probe:Drosophila_2:1630669_at:228:539; Interrogation_Position=423; Antisense; GGTAACTCCGAAGCTAACGCCAATG
>probe:Drosophila_2:1630669_at:54:661; Interrogation_Position=437; Antisense; TAACGCCAATGCCAATGCTGTCGCC
>probe:Drosophila_2:1630669_at:509:597; Interrogation_Position=455; Antisense; TGTCGCCAACTCTGACGGAGGATTT
>probe:Drosophila_2:1630669_at:359:519; Interrogation_Position=484; Antisense; GTGGTAATGCCAATGCAAACGCCAA
>probe:Drosophila_2:1630669_at:14:189; Interrogation_Position=519; Antisense; AACACCCGAGGTGGCAGTGCTAATG
>probe:Drosophila_2:1630669_at:702:505; Interrogation_Position=535; Antisense; GTGCTAATGCTAACGCCAATGCCGT
>probe:Drosophila_2:1630669_at:382:503; Interrogation_Position=558; Antisense; GTCGCCAACGCATTCCGCAAATAAG
>probe:Drosophila_2:1630669_at:526:297; Interrogation_Position=573; Antisense; CGCAAATAAGCCAACAGATCCGAAT
>probe:Drosophila_2:1630669_at:309:95; Interrogation_Position=588; Antisense; AGATCCGAATTTATTCACTGAGTAG
>probe:Drosophila_2:1630669_at:282:493; Interrogation_Position=72; Antisense; GTAATCCTGGCCGTGTCCAGTGCCG
>probe:Drosophila_2:1630669_at:198:503; Interrogation_Position=91; Antisense; GTGCCGCCCCGCAGTTTAATAATGG

Paste this into a BLAST search page for me
AATGCTAACGCAAATGCCAACGCAAGTGGAAGACCAGGATTCAGCGGACCGATTCAGCGGACCTGGTTTCCAGAAGGTAACTCCGAAGCTAACGCCAATGTAACGCCAATGCCAATGCTGTCGCCTGTCGCCAACTCTGACGGAGGATTTGTGGTAATGCCAATGCAAACGCCAAAACACCCGAGGTGGCAGTGCTAATGGTGCTAATGCTAACGCCAATGCCGTGTCGCCAACGCATTCCGCAAATAAGCGCAAATAAGCCAACAGATCCGAATAGATCCGAATTTATTCACTGAGTAGGTAATCCTGGCCGTGTCCAGTGCCGGTGCCGCCCCGCAGTTTAATAATGG

Full Affymetrix probeset data:

Annotations for 1630669_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720