FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630670_at:

>probe:Drosophila_2:1630670_at:46:263; Interrogation_Position=230; Antisense; CAGCCATCCAGCAGTCGTATGTCGC
>probe:Drosophila_2:1630670_at:291:707; Interrogation_Position=359; Antisense; TTAGCTACTCGGCACCCTCTGTGAG
>probe:Drosophila_2:1630670_at:549:641; Interrogation_Position=376; Antisense; TCTGTGAGCTACTCGGCTCCATCGG
>probe:Drosophila_2:1630670_at:635:667; Interrogation_Position=385; Antisense; TACTCGGCTCCATCGGTCAGCTACT
>probe:Drosophila_2:1630670_at:378:337; Interrogation_Position=412; Antisense; GCTCCTGCTGTCCAGCAGTCGTACT
>probe:Drosophila_2:1630670_at:538:667; Interrogation_Position=571; Antisense; TACTCTGCACCCTCCGTGGATGTGG
>probe:Drosophila_2:1630670_at:627:517; Interrogation_Position=586; Antisense; GTGGATGTGGGCACCCAGTACGCCT
>probe:Drosophila_2:1630670_at:566:85; Interrogation_Position=602; Antisense; AGTACGCCTCCAACGGTGGCTACGT
>probe:Drosophila_2:1630670_at:201:197; Interrogation_Position=613; Antisense; AACGGTGGCTACGTCTACAGGAAGT
>probe:Drosophila_2:1630670_at:571:485; Interrogation_Position=636; Antisense; GTAGGGATCTTCAACGAAGAGGCCT
>probe:Drosophila_2:1630670_at:614:213; Interrogation_Position=652; Antisense; AAGAGGCCTGCAACTGAACACGAAA
>probe:Drosophila_2:1630670_at:153:359; Interrogation_Position=661; Antisense; GCAACTGAACACGAAACAGTGTCCA
>probe:Drosophila_2:1630670_at:158:85; Interrogation_Position=678; Antisense; AGTGTCCATAACTACATACTGCCCA
>probe:Drosophila_2:1630670_at:442:279; Interrogation_Position=689; Antisense; CTACATACTGCCCAAATTAACCATA

Paste this into a BLAST search page for me
CAGCCATCCAGCAGTCGTATGTCGCTTAGCTACTCGGCACCCTCTGTGAGTCTGTGAGCTACTCGGCTCCATCGGTACTCGGCTCCATCGGTCAGCTACTGCTCCTGCTGTCCAGCAGTCGTACTTACTCTGCACCCTCCGTGGATGTGGGTGGATGTGGGCACCCAGTACGCCTAGTACGCCTCCAACGGTGGCTACGTAACGGTGGCTACGTCTACAGGAAGTGTAGGGATCTTCAACGAAGAGGCCTAAGAGGCCTGCAACTGAACACGAAAGCAACTGAACACGAAACAGTGTCCAAGTGTCCATAACTACATACTGCCCACTACATACTGCCCAAATTAACCATA

Full Affymetrix probeset data:

Annotations for 1630670_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720