Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630672_at:

>probe:Drosophila_2:1630672_at:381:503; Interrogation_Position=142; Antisense; GTCGCCAGGCGATCACGTTATACAG
>probe:Drosophila_2:1630672_at:556:153; Interrogation_Position=163; Antisense; ACAGGAATCTCCTGCGCGAATCGGA
>probe:Drosophila_2:1630672_at:663:207; Interrogation_Position=189; Antisense; AAGCTGCCCTCGTACAACTTCAGAA
>probe:Drosophila_2:1630672_at:391:191; Interrogation_Position=204; Antisense; AACTTCAGAATGTACGCTGCCCGAA
>probe:Drosophila_2:1630672_at:614:335; Interrogation_Position=219; Antisense; GCTGCCCGAAAAATACGCGACACAT
>probe:Drosophila_2:1630672_at:2:155; Interrogation_Position=253; Antisense; ACAGGAGCACCAGGGACTTCGCGGA
>probe:Drosophila_2:1630672_at:680:401; Interrogation_Position=267; Antisense; GACTTCGCGGAGATCGATCGCCAAA
>probe:Drosophila_2:1630672_at:494:553; Interrogation_Position=314; Antisense; GGAGCTGATACGTCGCCAGGTAATC
>probe:Drosophila_2:1630672_at:633:493; Interrogation_Position=333; Antisense; GTAATCATCGGCCACCTGTATTCCG
>probe:Drosophila_2:1630672_at:593:479; Interrogation_Position=350; Antisense; GTATTCCGCTGACAAACTGGTTATA
>probe:Drosophila_2:1630672_at:353:209; Interrogation_Position=381; Antisense; AAGAAGACCCTGAAGCCCTCGGACG
>probe:Drosophila_2:1630672_at:717:175; Interrogation_Position=428; Antisense; AAACGCGCTAGCTGAAGAGAGTACA
>probe:Drosophila_2:1630672_at:176:155; Interrogation_Position=539; Antisense; ACACCAAACCACACGCATTGTTGAT
>probe:Drosophila_2:1630672_at:58:67; Interrogation_Position=569; Antisense; ATGGCACTTGCATTCATGAAACTAA

Paste this into a BLAST search page for me
GTCGCCAGGCGATCACGTTATACAGACAGGAATCTCCTGCGCGAATCGGAAAGCTGCCCTCGTACAACTTCAGAAAACTTCAGAATGTACGCTGCCCGAAGCTGCCCGAAAAATACGCGACACATACAGGAGCACCAGGGACTTCGCGGAGACTTCGCGGAGATCGATCGCCAAAGGAGCTGATACGTCGCCAGGTAATCGTAATCATCGGCCACCTGTATTCCGGTATTCCGCTGACAAACTGGTTATAAAGAAGACCCTGAAGCCCTCGGACGAAACGCGCTAGCTGAAGAGAGTACAACACCAAACCACACGCATTGTTGATATGGCACTTGCATTCATGAAACTAA

Full Affymetrix probeset data:

Annotations for 1630672_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime