FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630673_at:

>probe:Drosophila_2:1630673_at:314:97; Interrogation_Position=149; Antisense; AGATCTCGCCCATCTGGAGGGATTT
>probe:Drosophila_2:1630673_at:396:151; Interrogation_Position=181; Antisense; ACATTTGTGACGGTTCTCAGCTGGA
>probe:Drosophila_2:1630673_at:89:589; Interrogation_Position=202; Antisense; TGGAGTTGGCTCATCTACGCACTTT
>probe:Drosophila_2:1630673_at:458:695; Interrogation_Position=224; Antisense; TTTCCGCACTGGTAATCATCACTTG
>probe:Drosophila_2:1630673_at:144:271; Interrogation_Position=240; Antisense; CATCACTTGTGCATATTTCGCTTAT
>probe:Drosophila_2:1630673_at:251:513; Interrogation_Position=266; Antisense; GTGAGCGCTGCCGAAGAACTGAATC
>probe:Drosophila_2:1630673_at:432:267; Interrogation_Position=290; Antisense; CAGTGCGACGACGACGGGTGATTCA
>probe:Drosophila_2:1630673_at:372:369; Interrogation_Position=351; Antisense; GAATGCGGCCTATCGGGATCACCAG
>probe:Drosophila_2:1630673_at:346:367; Interrogation_Position=417; Antisense; GAATCCGGATGGTATTCGACCCTTT
>probe:Drosophila_2:1630673_at:520:113; Interrogation_Position=455; Antisense; AGCAGCTATATCCACTCAGGCATAA
>probe:Drosophila_2:1630673_at:56:273; Interrogation_Position=475; Antisense; CATAACTTGGCCGATCAGCAGCAGG
>probe:Drosophila_2:1630673_at:164:185; Interrogation_Position=56; Antisense; AAAAGGTAGCCAGTCGCAGCCAGTC
>probe:Drosophila_2:1630673_at:79:355; Interrogation_Position=71; Antisense; GCAGCCAGTCGATCAGGCCAATGAT
>probe:Drosophila_2:1630673_at:206:59; Interrogation_Position=94; Antisense; ATGATGCCTCAATTTGTGTTCTGGA

Paste this into a BLAST search page for me
AGATCTCGCCCATCTGGAGGGATTTACATTTGTGACGGTTCTCAGCTGGATGGAGTTGGCTCATCTACGCACTTTTTTCCGCACTGGTAATCATCACTTGCATCACTTGTGCATATTTCGCTTATGTGAGCGCTGCCGAAGAACTGAATCCAGTGCGACGACGACGGGTGATTCAGAATGCGGCCTATCGGGATCACCAGGAATCCGGATGGTATTCGACCCTTTAGCAGCTATATCCACTCAGGCATAACATAACTTGGCCGATCAGCAGCAGGAAAAGGTAGCCAGTCGCAGCCAGTCGCAGCCAGTCGATCAGGCCAATGATATGATGCCTCAATTTGTGTTCTGGA

Full Affymetrix probeset data:

Annotations for 1630673_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720