FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630674_at:

>probe:Drosophila_2:1630674_at:307:695; Interrogation_Position=816; Antisense; TTCTACAGCGGGTTGGTTAGTTCTC
>probe:Drosophila_2:1630674_at:365:623; Interrogation_Position=817; Antisense; TCTACAGCGGGTTGGTTAGTTCTCC
>probe:Drosophila_2:1630674_at:98:665; Interrogation_Position=819; Antisense; TACAGCGGGTTGGTTAGTTCTCCCT
>probe:Drosophila_2:1630674_at:595:677; Interrogation_Position=833; Antisense; TAGTTCTCCCTTAAGAAACTCAATT
>probe:Drosophila_2:1630674_at:95:391; Interrogation_Position=847; Antisense; GAAACTCAATTAACTTCCTATTGTT
>probe:Drosophila_2:1630674_at:509:245; Interrogation_Position=853; Antisense; CAATTAACTTCCTATTGTTTTCAGT
>probe:Drosophila_2:1630674_at:30:149; Interrogation_Position=859; Antisense; ACTTCCTATTGTTTTCAGTTACATC
>probe:Drosophila_2:1630674_at:278:721; Interrogation_Position=861; Antisense; TTCCTATTGTTTTCAGTTACATCAG
>probe:Drosophila_2:1630674_at:311:689; Interrogation_Position=865; Antisense; TATTGTTTTCAGTTACATCAGTCTA
>probe:Drosophila_2:1630674_at:262:725; Interrogation_Position=867; Antisense; TTGTTTTCAGTTACATCAGTCTAAA
>probe:Drosophila_2:1630674_at:250:475; Interrogation_Position=876; Antisense; GTTACATCAGTCTAAACTGTCAGAG
>probe:Drosophila_2:1630674_at:719:265; Interrogation_Position=883; Antisense; CAGTCTAAACTGTCAGAGAGCCCGT
>probe:Drosophila_2:1630674_at:28:499; Interrogation_Position=885; Antisense; GTCTAAACTGTCAGAGAGCCCGTGA
>probe:Drosophila_2:1630674_at:154:663; Interrogation_Position=888; Antisense; TAAACTGTCAGAGAGCCCGTGAACT

Paste this into a BLAST search page for me
TTCTACAGCGGGTTGGTTAGTTCTCTCTACAGCGGGTTGGTTAGTTCTCCTACAGCGGGTTGGTTAGTTCTCCCTTAGTTCTCCCTTAAGAAACTCAATTGAAACTCAATTAACTTCCTATTGTTCAATTAACTTCCTATTGTTTTCAGTACTTCCTATTGTTTTCAGTTACATCTTCCTATTGTTTTCAGTTACATCAGTATTGTTTTCAGTTACATCAGTCTATTGTTTTCAGTTACATCAGTCTAAAGTTACATCAGTCTAAACTGTCAGAGCAGTCTAAACTGTCAGAGAGCCCGTGTCTAAACTGTCAGAGAGCCCGTGATAAACTGTCAGAGAGCCCGTGAACT

Full Affymetrix probeset data:

Annotations for 1630674_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720