FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630675_at:

>probe:Drosophila_2:1630675_at:181:513; Interrogation_Position=311; Antisense; GTGAGGCTCACCTGTGGCACTACTG
>probe:Drosophila_2:1630675_at:586:49; Interrogation_Position=342; Antisense; ATGCCAAAAGCTGGTGCCACCGAGG
>probe:Drosophila_2:1630675_at:160:305; Interrogation_Position=361; Antisense; CCGAGGTCCTGGCACTGTAGTTTGT
>probe:Drosophila_2:1630675_at:169:35; Interrogation_Position=452; Antisense; ATCAGAGGTATTTCCTTGCCTTCTT
>probe:Drosophila_2:1630675_at:564:713; Interrogation_Position=472; Antisense; TTCTTGTTTCACCTGAGCTTTGGCA
>probe:Drosophila_2:1630675_at:30:69; Interrogation_Position=503; Antisense; AGGCGCTCGTCTACAATGGCATTTT
>probe:Drosophila_2:1630675_at:465:251; Interrogation_Position=540; Antisense; CAAGGCCTTTTTGGTCGTCGATCCT
>probe:Drosophila_2:1630675_at:609:499; Interrogation_Position=556; Antisense; GTCGATCCTTTGTTGCTAATGTTCC
>probe:Drosophila_2:1630675_at:295:543; Interrogation_Position=582; Antisense; GGATACAACCCAAGATGCTGATTTC
>probe:Drosophila_2:1630675_at:592:583; Interrogation_Position=610; Antisense; TGGAAGTACACAATCGCCAACCTTT
>probe:Drosophila_2:1630675_at:661:301; Interrogation_Position=665; Antisense; CCCTCTTCATGTTCGTCTTTCAAAT
>probe:Drosophila_2:1630675_at:326:447; Interrogation_Position=723; Antisense; GATGCTCGATCGCAGCTATGATGTT
>probe:Drosophila_2:1630675_at:123:61; Interrogation_Position=769; Antisense; ATGGTCTTGGGAAAACGGCGCTTCT
>probe:Drosophila_2:1630675_at:407:67; Interrogation_Position=836; Antisense; ATGGCACTCAGTGGTTCCAGAAGCA

Paste this into a BLAST search page for me
GTGAGGCTCACCTGTGGCACTACTGATGCCAAAAGCTGGTGCCACCGAGGCCGAGGTCCTGGCACTGTAGTTTGTATCAGAGGTATTTCCTTGCCTTCTTTTCTTGTTTCACCTGAGCTTTGGCAAGGCGCTCGTCTACAATGGCATTTTCAAGGCCTTTTTGGTCGTCGATCCTGTCGATCCTTTGTTGCTAATGTTCCGGATACAACCCAAGATGCTGATTTCTGGAAGTACACAATCGCCAACCTTTCCCTCTTCATGTTCGTCTTTCAAATGATGCTCGATCGCAGCTATGATGTTATGGTCTTGGGAAAACGGCGCTTCTATGGCACTCAGTGGTTCCAGAAGCA

Full Affymetrix probeset data:

Annotations for 1630675_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720