Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630676_at:

>probe:Drosophila_2:1630676_at:193:95; Interrogation_Position=6120; Antisense; AGTTGCTCCACTGGCCAAGTCTGAA
>probe:Drosophila_2:1630676_at:506:395; Interrogation_Position=6142; Antisense; GAAATCTCGAATATGGCGCCGCCAG
>probe:Drosophila_2:1630676_at:142:579; Interrogation_Position=6222; Antisense; GGCCGACACCCATCATTGTGGTGGA
>probe:Drosophila_2:1630676_at:505:587; Interrogation_Position=6243; Antisense; TGGAGAACTACGATGTCCGCCGTGT
>probe:Drosophila_2:1630676_at:241:619; Interrogation_Position=6294; Antisense; TGCATCCGCAGACGAGTAGGGCCTC
>probe:Drosophila_2:1630676_at:280:483; Interrogation_Position=6309; Antisense; GTAGGGCCTCAGTGGGTCACATCGA
>probe:Drosophila_2:1630676_at:398:435; Interrogation_Position=6332; Antisense; GAGGTGGCCGGCAGCGAACATCTTC
>probe:Drosophila_2:1630676_at:17:185; Interrogation_Position=6363; Antisense; AAAAGGCCAACTACTGGCAGCGCCG
>probe:Drosophila_2:1630676_at:209:101; Interrogation_Position=6445; Antisense; AGAGTCTAGTCACCCACATCGGGAT
>probe:Drosophila_2:1630676_at:596:541; Interrogation_Position=6466; Antisense; GGATTCCATGAATTCCCATTCGAAT
>probe:Drosophila_2:1630676_at:631:447; Interrogation_Position=6503; Antisense; GATCCCACGGCCAATTGCAACGATT
>probe:Drosophila_2:1630676_at:524:465; Interrogation_Position=6524; Antisense; GATTGTGTGGCCCAATGACTGGCAA
>probe:Drosophila_2:1630676_at:234:697; Interrogation_Position=6638; Antisense; TTTACGTAGTTTTGGCCATGCCTAG
>probe:Drosophila_2:1630676_at:198:49; Interrogation_Position=6655; Antisense; ATGCCTAGTTGTTTCCCAGTAGTCA

Paste this into a BLAST search page for me
AGTTGCTCCACTGGCCAAGTCTGAAGAAATCTCGAATATGGCGCCGCCAGGGCCGACACCCATCATTGTGGTGGATGGAGAACTACGATGTCCGCCGTGTTGCATCCGCAGACGAGTAGGGCCTCGTAGGGCCTCAGTGGGTCACATCGAGAGGTGGCCGGCAGCGAACATCTTCAAAAGGCCAACTACTGGCAGCGCCGAGAGTCTAGTCACCCACATCGGGATGGATTCCATGAATTCCCATTCGAATGATCCCACGGCCAATTGCAACGATTGATTGTGTGGCCCAATGACTGGCAATTTACGTAGTTTTGGCCATGCCTAGATGCCTAGTTGTTTCCCAGTAGTCA

Full Affymetrix probeset data:

Annotations for 1630676_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime