FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630677_at:

>probe:Drosophila_2:1630677_at:415:317; Interrogation_Position=2961; Antisense; GCCGGAGGTAAATATCTTGCTGGAC
>probe:Drosophila_2:1630677_at:670:309; Interrogation_Position=3068; Antisense; CCACGGCTGATGCTGCCAAGGTGAA
>probe:Drosophila_2:1630677_at:13:269; Interrogation_Position=3132; Antisense; CAGGACTCTGAAGGCCACTGGAGAT
>probe:Drosophila_2:1630677_at:331:97; Interrogation_Position=3153; Antisense; AGATGCCGCCGTGTGGAAACCCGAA
>probe:Drosophila_2:1630677_at:215:373; Interrogation_Position=3175; Antisense; GAAGTTGATATTCTGTTGTCCCTCA
>probe:Drosophila_2:1630677_at:431:467; Interrogation_Position=3189; Antisense; GTTGTCCCTCAAAAACGAGCTGGCG
>probe:Drosophila_2:1630677_at:637:331; Interrogation_Position=3216; Antisense; GCTGACTGGAACACCGGTCGCTGGT
>probe:Drosophila_2:1630677_at:628:485; Interrogation_Position=3267; Antisense; GTAGACATCACACTTCCTAACTAAA
>probe:Drosophila_2:1630677_at:293:185; Interrogation_Position=3290; Antisense; AAAATCACGCTGGACGCTTTTACCT
>probe:Drosophila_2:1630677_at:56:699; Interrogation_Position=3308; Antisense; TTTACCTCAGCCCTTTTAATCAGGC
>probe:Drosophila_2:1630677_at:312:441; Interrogation_Position=3337; Antisense; GATGGCAAATCTTTAGTCACGGACT
>probe:Drosophila_2:1630677_at:243:679; Interrogation_Position=3350; Antisense; TAGTCACGGACTGGCACAGTTCAAT
>probe:Drosophila_2:1630677_at:23:155; Interrogation_Position=3365; Antisense; ACAGTTCAATTCATCTCCCATAAGT
>probe:Drosophila_2:1630677_at:253:629; Interrogation_Position=3378; Antisense; TCTCCCATAAGTTTTGCGTTTGCAT

Paste this into a BLAST search page for me
GCCGGAGGTAAATATCTTGCTGGACCCACGGCTGATGCTGCCAAGGTGAACAGGACTCTGAAGGCCACTGGAGATAGATGCCGCCGTGTGGAAACCCGAAGAAGTTGATATTCTGTTGTCCCTCAGTTGTCCCTCAAAAACGAGCTGGCGGCTGACTGGAACACCGGTCGCTGGTGTAGACATCACACTTCCTAACTAAAAAAATCACGCTGGACGCTTTTACCTTTTACCTCAGCCCTTTTAATCAGGCGATGGCAAATCTTTAGTCACGGACTTAGTCACGGACTGGCACAGTTCAATACAGTTCAATTCATCTCCCATAAGTTCTCCCATAAGTTTTGCGTTTGCAT

Full Affymetrix probeset data:

Annotations for 1630677_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720