Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630679_at:

>probe:Drosophila_2:1630679_at:127:191; Interrogation_Position=1099; Antisense; AACTTGGGCAACTTCTTTTGCGACG
>probe:Drosophila_2:1630679_at:263:315; Interrogation_Position=1123; Antisense; GCCATGGTTCATTCTTTCGTCGGAA
>probe:Drosophila_2:1630679_at:527:691; Interrogation_Position=1169; Antisense; TTTGGACGAATGTATCCGCCGGACT
>probe:Drosophila_2:1630679_at:684:361; Interrogation_Position=1232; Antisense; GCAATCTTACGTACGCCCATATAGT
>probe:Drosophila_2:1630679_at:408:21; Interrogation_Position=1250; Antisense; ATATAGTCAGCATGTCGCCCTTCGA
>probe:Drosophila_2:1630679_at:544:423; Interrogation_Position=1273; Antisense; GAGAACACGCTGGTTTCCTACAATC
>probe:Drosophila_2:1630679_at:574:489; Interrogation_Position=1374; Antisense; GTACATCAATCTGCAGTTCTCGGGC
>probe:Drosophila_2:1630679_at:107:205; Interrogation_Position=1423; Antisense; AAGCCGGTGGGATCGCGTGTCATAT
>probe:Drosophila_2:1630679_at:610:489; Interrogation_Position=1450; Antisense; GTAACGATTCGTTGTGCGGACTGCG
>probe:Drosophila_2:1630679_at:644:89; Interrogation_Position=1484; Antisense; AGTACGAGCCTCTGGTATCCGACAA
>probe:Drosophila_2:1630679_at:100:551; Interrogation_Position=1594; Antisense; GGAGTCACGGACTTGGATGCCCTAA
>probe:Drosophila_2:1630679_at:109:547; Interrogation_Position=1608; Antisense; GGATGCCCTAATCTCGTACAGCAAT
>probe:Drosophila_2:1630679_at:363:667; Interrogation_Position=1624; Antisense; TACAGCAATCACATCAATCCCATTT
>probe:Drosophila_2:1630679_at:139:435; Interrogation_Position=1660; Antisense; GAGGGACGCATCACAGTGCTCAACT

Paste this into a BLAST search page for me
AACTTGGGCAACTTCTTTTGCGACGGCCATGGTTCATTCTTTCGTCGGAATTTGGACGAATGTATCCGCCGGACTGCAATCTTACGTACGCCCATATAGTATATAGTCAGCATGTCGCCCTTCGAGAGAACACGCTGGTTTCCTACAATCGTACATCAATCTGCAGTTCTCGGGCAAGCCGGTGGGATCGCGTGTCATATGTAACGATTCGTTGTGCGGACTGCGAGTACGAGCCTCTGGTATCCGACAAGGAGTCACGGACTTGGATGCCCTAAGGATGCCCTAATCTCGTACAGCAATTACAGCAATCACATCAATCCCATTTGAGGGACGCATCACAGTGCTCAACT

Full Affymetrix probeset data:

Annotations for 1630679_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime