FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630680_at:

>probe:Drosophila_2:1630680_at:199:471; Interrogation_Position=1023; Antisense; GTTATGGACAACCTGTGCATCCTGC
>probe:Drosophila_2:1630680_at:675:419; Interrogation_Position=1065; Antisense; GAGAAAATCTTCGTCTTCCTTTGGG
>probe:Drosophila_2:1630680_at:567:645; Interrogation_Position=1102; Antisense; TCATGGCCCTGATGTCCGGTTTGAA
>probe:Drosophila_2:1630680_at:515:17; Interrogation_Position=1149; Antisense; ATTTGCAGCAGGTATCTCCGAGAGC
>probe:Drosophila_2:1630680_at:40:263; Interrogation_Position=1184; Antisense; CAGCCAGTTGCGTTTCATGACCAAA
>probe:Drosophila_2:1630680_at:423:41; Interrogation_Position=1242; Antisense; ATCGGCGACTGGTTCCTGATGATGA
>probe:Drosophila_2:1630680_at:215:329; Interrogation_Position=1273; Antisense; GCGTCAACGTAAATCCTATGCTCTT
>probe:Drosophila_2:1630680_at:269:587; Interrogation_Position=1354; Antisense; TGGAGAGTCCCGTCTAGGATCGCTA
>probe:Drosophila_2:1630680_at:152:43; Interrogation_Position=1372; Antisense; ATCGCTAGTGATCAGGTCCACGGAT
>probe:Drosophila_2:1630680_at:420:457; Interrogation_Position=1394; Antisense; GATTGGATTAGGATCCCCAGTTCGC
>probe:Drosophila_2:1630680_at:713:405; Interrogation_Position=1429; Antisense; GACTGCCGACTATCAATTGACGTTG
>probe:Drosophila_2:1630680_at:335:467; Interrogation_Position=1450; Antisense; GTTGCTGTCGTTCGTTAATTCGTGC
>probe:Drosophila_2:1630680_at:654:9; Interrogation_Position=1467; Antisense; ATTCGTGCCCTTTGCATATATCTAA
>probe:Drosophila_2:1630680_at:588:343; Interrogation_Position=1503; Antisense; GCATATATTTCCTCTCAATTCCTTT

Paste this into a BLAST search page for me
GTTATGGACAACCTGTGCATCCTGCGAGAAAATCTTCGTCTTCCTTTGGGTCATGGCCCTGATGTCCGGTTTGAAATTTGCAGCAGGTATCTCCGAGAGCCAGCCAGTTGCGTTTCATGACCAAAATCGGCGACTGGTTCCTGATGATGAGCGTCAACGTAAATCCTATGCTCTTTGGAGAGTCCCGTCTAGGATCGCTAATCGCTAGTGATCAGGTCCACGGATGATTGGATTAGGATCCCCAGTTCGCGACTGCCGACTATCAATTGACGTTGGTTGCTGTCGTTCGTTAATTCGTGCATTCGTGCCCTTTGCATATATCTAAGCATATATTTCCTCTCAATTCCTTT

Full Affymetrix probeset data:

Annotations for 1630680_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720